RchiOBHm_Chr5g0046261

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
42326665 .. 42328308
1644 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32427

Sequence Viewer

Length: 285 bp
ATGGAGACAGAAACGACGGCGATTCTAATCGACCTGGGTAATATCATGGCTGTTGACCTTCATCATCAATTTACGTCCAACCCTTTTTCAAGACTATACAAATTTGGGTGCAACTGTGCAAAGAAGATGGTTGTGATAAATTTAGGACCTATTGAATGTATACCCTTTCAGAGGGAAGTAAATCTGCTAGCTAATCCAGATAAGTATGCTGAATTCCCAAATCAATTGGCACAGTCATTCAACTCCAAGCTAAGGACCAATATAATGAGCCTTAGAATCTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.7

Weight (kDa)

7.74

Isoelectric Point (pI)

54.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018102)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 283
AccI GTMKAC 1 cut(s) 160
AcsI RAATTY 3 cut(s) 101, 139, 212
AfiI CCNNNNNNNGG 2 cut(s) 171, 252
AgsI TTSAA 3 cut(s) 90, 155, 241
AjnI CCWGG 1 cut(s) 33
AluBI AGCT 2 cut(s) 191, 250
AluI AGCT 2 cut(s) 191, 250
ApoI RAATTY 3 cut(s) 101, 139, 212
AspS9I GGNCC 2 cut(s) 146, 255
AsuNHI GCTAGC 1 cut(s) 187
AvaII GGWCC 2 cut(s) 146, 255
BccI CCATC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 33
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 35
Bme18I GGWCC 2 cut(s) 146, 255
BmgT120I GGNCC 2 cut(s) 146, 255
BmrFI CCNGG 1 cut(s) 35
BmtI GCTAGC 1 cut(s) 191
Bpu10I CCTNAGC 1 cut(s) 251
BsaBI GATNNNNATC 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 2 cut(s) 171, 252
Bse8I GATNNNNATC 1 cut(s) 26
BseBI CCWGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 34
BseJI GATNNNNATC 1 cut(s) 26
BseLI CCNNNNNNNGG 2 cut(s) 171, 252
BslI CCNNNNNNNGG 2 cut(s) 171, 252
BspOI GCTAGC 1 cut(s) 191
BssECI CCNNGG 1 cut(s) 34
BssNAI GTATAC 1 cut(s) 161
Bst1107I GTATAC 1 cut(s) 161
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 2 cut(s) 116, 234
BstC8I GCNNGC 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 251, 272
BstENI CCTNNNNNAGG 1 cut(s) 169
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
BstZ17I GTATAC 1 cut(s) 161
Cac8I GCNNGC 1 cut(s) 189
Cfr13I GGNCC 2 cut(s) 146, 255
CviAII CATG 1 cut(s) 46
CviJI RGCY 4 cut(s) 50, 191, 250, 270
CviKI_1 RGCY 4 cut(s) 50, 191, 250, 270
DdeI CTNAG 2 cut(s) 251, 272
Eco47I GGWCC 2 cut(s) 146, 255
EcoNI CCTNNNNNAGG 1 cut(s) 169
EcoO109I RGGNCCY 1 cut(s) 146
EcoRI GAATTC 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 33
FaeI CATG 1 cut(s) 49
FaiI YATR 6 cut(s) 47, 97, 161, 207, 263, 283
FatI CATG 1 cut(s) 45
FblI GTMKAC 1 cut(s) 160
FspBI CTAG 1 cut(s) 188
Hin1II CATG 1 cut(s) 49
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 2 cut(s) 22, 276
Hpy166II GTNNAC 2 cut(s) 55, 161
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 2 cut(s) 90, 197
Hpy8I GTNNAC 2 cut(s) 55, 161
Hpy99I CGWCG 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 2 cut(s) 116, 234
HpyCH4IV ACGT 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 111, 119
HpyF3I CTNAG 2 cut(s) 251, 272
HpySE526I ACGT 1 cut(s) 74
Hsp92II CATG 1 cut(s) 49
LpnPI CCDG 3 cut(s) 20, 47, 210
MaeI CTAG 1 cut(s) 188
MaeII ACGT 1 cut(s) 74
MboII GAAGA 1 cut(s) 136
MfeI CAATTG 1 cut(s) 224
MluCI AATT 5 cut(s) 68, 101, 139, 212, 224
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 1 cut(s) 165
MspR9I CCNGG 1 cut(s) 35
MunI CAATTG 1 cut(s) 224
MvaI CCWGG 1 cut(s) 35
NheI GCTAGC 1 cut(s) 187
NlaIII CATG 1 cut(s) 49
PfeI GAWTC 2 cut(s) 22, 276
PpuMI RGGWCCY 1 cut(s) 146
PsiI TTATAA 1 cut(s) 283
Psp5II RGGWCCY 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
PspPI GGNCC 2 cut(s) 146, 255
PspPPI RGGWCCY 1 cut(s) 146
Sau96I GGNCC 2 cut(s) 146, 255
ScrFI CCNGG 1 cut(s) 35
SetI ASST 6 cut(s) 36, 60, 77, 151, 193, 252
SgeI CNNG 7 cut(s) 46, 47, 58, 102, 200, 209, 259
SinI GGWCC 2 cut(s) 146, 255
Sse9I AATT 5 cut(s) 68, 101, 139, 212, 224
SspMI CTAG 1 cut(s) 188
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 2 cut(s) 116, 234
TaiI ACGT 1 cut(s) 77
TaqI TCGA 1 cut(s) 30
TasI AATT 5 cut(s) 68, 101, 139, 212, 224
TfiI GAWTC 2 cut(s) 22, 276
TspDTI ATGAA 1 cut(s) 50
VpaK11BI GGWCC 2 cut(s) 146, 255
XagI CCTNNNNNAGG 1 cut(s) 169
XapI RAATTY 3 cut(s) 101, 139, 212
XmiI GTMKAC 1 cut(s) 160
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.