Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8339355.1

Orthogroup ID

OG0018102

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 799

Gene Structure 799 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8339355.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 243 bp

atggagaccgatacgacggcgtttcaaatcgacgtgggtaatctcatggctgtggaccttcatcaccaattcccctccaacccttcttccagggaggaattggtgaaggaatatattgcaagaggaactgagttagttcaagctattgcgaataatctttttaatttgccttcgactgaagacattgagggtaccctcgtgaagttgcctgctccaacaactagattgcccagagagaagcat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000054 GO:0000055 GO:0000447 GO:0000460 GO:0000462 GO:0000466 GO:0000469 GO:0000478 GO:0000479 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006139 GO:0006364 GO:0006396 GO:0006403 GO:0006405 GO:0006611 GO:0006725 GO:0006807 GO:0006810 GO:0006811 GO:0006820 GO:0006862 GO:0006886 GO:0006913 GO:0008104 GO:0008150 GO:0008152 GO:0009987 GO:0010467 GO:0015031 GO:0015711 GO:0015748 GO:0015780 GO:0015833 GO:0015865 GO:0015866 GO:0015868 GO:0015931 GO:0016070 GO:0016072 GO:0022613 GO:0030490 GO:0030684 GO:0030687 GO:0031503 GO:0031974 GO:0031981 GO:0032991 GO:0033036 GO:0033750 GO:0034470 GO:0034613 GO:0034641 GO:0034660 GO:0042254 GO:0042273 GO:0042274 GO:0042886 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044085 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0045184 GO:0046483 GO:0046907 GO:0050657 GO:0050658 GO:0051168 GO:0051169 GO:0051179 GO:0051234 GO:0051236 GO:0051503 GO:0051640 GO:0051641 GO:0051649 GO:0051656 GO:0055085 GO:0070013 GO:0070727 GO:0071166 GO:0071426 GO:0071428 GO:0071702 GO:0071704 GO:0071705 GO:0071840 GO:0090304 GO:0090305 GO:0090480 GO:0090501 GO:0090502 GO:1901264 GO:1901360 GO:1990904

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RRS1

Protein Analysis

81

Amino Acids

9.06

Weight (kDa)

4.98

Isoelectric Point (pI)

41.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018102)

Species	Orthologous Gene IDs
malus_domestica	MD07G1185400.v1.1 MD09G1271900.v1.1
pyrus_communis	pycom02g11260 pycom05g07370
rosa_chinensis	RchiOBHm_Chr1g0344651 RchiOBHm_Chr5g0046261 RchiOBHm_Chr5g0046511 RchiOBHm_Chr5g0048851
rosa_multiflora	Rmu_co8339355.1_g000001
rosa_rugosa	Rorug01G0268500
rosa_samantha	Rh3DG328200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	191
AccB1I	GGYRCC	1 cut(s)	191
AcuI	CTGAAG	1 cut(s)	198
AfaI	GTAC	1 cut(s)	193
AgsI	TTSAA	2 cut(s)	26, 140
AjiI	CACGTC	1 cut(s)	34
AjnI	CCWGG	1 cut(s)	89
AluBI	AGCT	1 cut(s)	143
AluI	AGCT	1 cut(s)	143
Asp718I	GGTACC	1 cut(s)	191
AspS9I	GGNCC	1 cut(s)	55
AsuHPI	GGTGA	2 cut(s)	56, 115
AvaII	GGWCC	1 cut(s)	55
BaeI	ACNNNNGTAYC	2 cut(s)	183, 216
BanI	GGYRCC	1 cut(s)	191
BauI	CACGAG	1 cut(s)	197
BbsI	GAAGAC	1 cut(s)	186
BceAI	ACGGC	1 cut(s)	33
BciT130I	CCWGG	1 cut(s)	91
BfaI	CTAG	1 cut(s)	222
Bme1390I	CCNGG	1 cut(s)	91
Bme18I	GGWCC	1 cut(s)	55
BmgBI	CACGTC	1 cut(s)	34
BmgT120I	GGNCC	1 cut(s)	55
BmiI	GGNNCC	1 cut(s)	193
BmrFI	CCNGG	1 cut(s)	91
BpiI	GAAGAC	1 cut(s)	186
BsaJI	CCNNGG	1 cut(s)	90
BseBI	CCWGG	1 cut(s)	91
BseDI	CCNNGG	1 cut(s)	90
BseMII	CTCAG	1 cut(s)	120
BshNI	GGYRCC	1 cut(s)	191
BspCNI	CTCAG	1 cut(s)	121
BspLI	GGNNCC	1 cut(s)	193
BspT107I	GGYRCC	1 cut(s)	191
BssECI	CCNNGG	1 cut(s)	90
BssSI	CACGAG	1 cut(s)	197
Bst2BI	CACGAG	1 cut(s)	197
Bst2UI	CCWGG	1 cut(s)	91
BstC8I	GCNNGC	1 cut(s)	210
BstDEI	CTNAG	1 cut(s)	129
BstNI	CCWGG	1 cut(s)	91
BstSCI	CCNGG	1 cut(s)	89
BstV2I	GAAGAC	1 cut(s)	186
BtrI	CACGTC	1 cut(s)	34
Cac8I	GCNNGC	1 cut(s)	210
Cfr13I	GGNCC	1 cut(s)	55
Csp6I	GTAC	1 cut(s)	192
CviAII	CATG	1 cut(s)	46
CviJI	RGCY	2 cut(s)	50, 143
CviKI_1	RGCY	2 cut(s)	50, 143
CviQI	GTAC	1 cut(s)	192
DdeI	CTNAG	1 cut(s)	129
Eco47I	GGWCC	1 cut(s)	55
Eco57I	CTGAAG	1 cut(s)	198
EcoRII	CCWGG	1 cut(s)	89
FaeI	CATG	1 cut(s)	49
FaiI	YATR	2 cut(s)	47, 114
FatI	CATG	1 cut(s)	45
FspBI	CTAG	1 cut(s)	222
Hin1II	CATG	1 cut(s)	49
HphI	GGTGA	2 cut(s)	56, 115
Hpy166II	GTNNAC	1 cut(s)	55
Hpy188III	TCNNGA	1 cut(s)	199
Hpy8I	GTNNAC	1 cut(s)	55
Hpy99I	CGWCG	2 cut(s)	19, 35
HpyAV	CCTTC	4 cut(s)	68, 93, 100, 180
HpyCH4IV	ACGT	1 cut(s)	33
HpyCH4V	TGCA	1 cut(s)	119
HpyF3I	CTNAG	1 cut(s)	129
HpySE526I	ACGT	1 cut(s)	33
Hsp92II	CATG	1 cut(s)	49
KpnI	GGTACC	1 cut(s)	195
LmnI	GCTCC	1 cut(s)	217
LpnPI	CCDG	3 cut(s)	76, 103, 222
MaeI	CTAG	1 cut(s)	222
MaeII	ACGT	1 cut(s)	33
MboII	GAAGA	2 cut(s)	78, 191
MluCI	AATT	3 cut(s)	68, 98, 163
MmeI	TCCRAC	2 cut(s)	102, 239
MnlI	CCTC	5 cut(s)	85, 88, 116, 181, 206
MseI	TTAA	1 cut(s)	162
MslI	CAYNNNNRTG	1 cut(s)	50
MspR9I	CCNGG	1 cut(s)	91
MvaI	CCWGG	1 cut(s)	91
NlaIII	CATG	1 cut(s)	49
NlaIV	GGNNCC	1 cut(s)	193
Psp6I	CCWGG	1 cut(s)	89
PspGI	CCWGG	1 cut(s)	89
PspN4I	GGNNCC	1 cut(s)	193
PspPI	GGNCC	1 cut(s)	55
RsaI	GTAC	1 cut(s)	193
RsaNI	GTAC	1 cut(s)	192
RseI	CAYNNNNRTG	1 cut(s)	50
SaqAI	TTAA	1 cut(s)	162
Sau96I	GGNCC	1 cut(s)	55
ScrFI	CCNGG	1 cut(s)	91
SetI	ASST	3 cut(s)	36, 60, 145
SinI	GGWCC	1 cut(s)	55
SmiMI	CAYNNNNRTG	1 cut(s)	50
Sse9I	AATT	3 cut(s)	68, 98, 163
SspMI	CTAG	1 cut(s)	222
StyD4I	CCNGG	1 cut(s)	89
TaiI	ACGT	1 cut(s)	36
TaqI	TCGA	2 cut(s)	30, 173
TaqII	GACCGA	1 cut(s)	23
TasI	AATT	3 cut(s)	68, 98, 163
Tru1I	TTAA	1 cut(s)	162
Tru9I	TTAA	1 cut(s)	162
TspDTI	ATGAA	1 cut(s)	50
VpaK11BI	GGWCC	1 cut(s)	55
XcmI	CCANNNNNNNNNTGG	1 cut(s)	97
XspI	CTAG	1 cut(s)	222

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.