RchiOBHm_Chr4g0387911
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
3082793 .. 3086171
3379 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGTCTTTCAATGCTATGAAGGATACAAGTGAGGTGAATTCCAAGATAATGGTATTTAACAATACTGCAGTGTCTTGTAGGCTTGAAATTAGACAAGCTGGAGAAGGGAGACATCATGTTCCAGGACTTGTTGAGGCACATGTGAAAAACATGAATGACGTCTAG

Protein Analysis

54

Amino Acids

6.01

Weight (kDa)

6.82

Isoelectric Point (pI)

32.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 37
AcyI GRCGYC 1 cut(s) 159
AflIII ACRYGT 1 cut(s) 139
AgsI TTSAA 2 cut(s) 10, 86
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw26I GTCTC 1 cut(s) 103
ApoI RAATTY 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 46
BciT130I CCWGG 1 cut(s) 123
BciVI GTATCC 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 103
BfaI CTAG 1 cut(s) 163
BfmI CTRYAG 1 cut(s) 66
BfuI GTATCC 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 120
BsaHI GRCGYC 1 cut(s) 159
BseBI CCWGG 1 cut(s) 123
BsmAI GTCTC 1 cut(s) 103
BspMAI CTGCAG 1 cut(s) 70
BssNI GRCGYC 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 123
BstACI GRCGYC 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 103
BstNI CCWGG 1 cut(s) 123
BstNSI RCATGY 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 66
BstXI CCANNNNNNTGG 1 cut(s) 49
BsuI GTATCC 1 cut(s) 16
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 3 cut(s) 116, 140, 151
CviJI RGCY 2 cut(s) 82, 98
CviKI_1 RGCY 2 cut(s) 82, 98
EcoRI GAATTC 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 3 cut(s) 119, 143, 154
FaiI YATR 4 cut(s) 17, 117, 141, 152
FatI CATG 3 cut(s) 115, 139, 150
FspBI CTAG 1 cut(s) 163
GsuI CTGGAG 1 cut(s) 120
Hin1I GRCGYC 1 cut(s) 159
Hin1II CATG 3 cut(s) 119, 143, 154
HphI GGTGA 1 cut(s) 46
HpyAV CCTTC 2 cut(s) 13, 98
HpyCH4IV ACGT 1 cut(s) 159
HpyCH4V TGCA 1 cut(s) 68
HpySE526I ACGT 1 cut(s) 159
Hsp92I GRCGYC 1 cut(s) 159
Hsp92II CATG 3 cut(s) 119, 143, 154
LpnPI CCDG 3 cut(s) 84, 108, 135
MaeI CTAG 1 cut(s) 163
MaeII ACGT 1 cut(s) 159
MluCI AATT 2 cut(s) 37, 87
MnlI CCTC 2 cut(s) 25, 127
MseI TTAA 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
NlaIII CATG 3 cut(s) 119, 143, 154
NspI RCATGY 1 cut(s) 143
PciI ACATGT 1 cut(s) 139
PfoI TCCNGGA 1 cut(s) 121
PscI ACATGT 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PstI CTGCAG 1 cut(s) 70
SaqAI TTAA 1 cut(s) 57
ScrFI CCNGG 1 cut(s) 123
SetI ASST 3 cut(s) 36, 100, 162
SfcI CTRYAG 1 cut(s) 66
Sse9I AATT 2 cut(s) 37, 87
SspMI CTAG 1 cut(s) 163
StyD4I CCNGG 1 cut(s) 121
TaiI ACGT 1 cut(s) 162
TasI AATT 2 cut(s) 37, 87
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TscAI CASTG 1 cut(s) 75
TspDTI ATGAA 1 cut(s) 32
TspRI CASTG 1 cut(s) 75
XapI RAATTY 1 cut(s) 37
XceI RCATGY 1 cut(s) 143
XspI CTAG 1 cut(s) 163
ZraI GACGTC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.