Rmu_sc0006221.1_g000008
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006221.1
Physical Location & Seq
Forward (+)
27263 .. 27589
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006221.1_g000008.1.cds

Sequence Viewer

Length: 327 bp
atgtctttcaatgctatgaaggatacaagtgaggtgaattccaagataatggtatctaacaatactgcagtgtcttgtaggcttgatattagacaagctagagaagggagacatcatgttccaggacttgttgaggcacacgtgaaaaacatgaatgacgtctgggaagttctccaaactgacagtaatgcaagggctgttggctcaaccaatgtcaataagcatagtagctgtgactttggattcagatatttttaccaagaattttgtatcccaatgcaagtgaagcatcttagaatggtggttctgcacattagacccgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.41

Weight (kDa)

8.56

Isoelectric Point (pI)

41.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 162
AcsI RAATTY 2 cut(s) 37, 263
AcvI CACGTG 1 cut(s) 142
AcyI GRCGYC 1 cut(s) 159
AflIII ACRYGT 1 cut(s) 139
AgsI TTSAA 1 cut(s) 10
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 2 cut(s) 98, 231
AluI AGCT 2 cut(s) 98, 231
Alw26I GTCTC 1 cut(s) 103
ApoI RAATTY 2 cut(s) 37, 263
AsuHPI GGTGA 1 cut(s) 46
BbrPI CACGTG 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 123
BciVI GTATCC 2 cut(s) 16, 281
BcoDI GTCTC 1 cut(s) 103
BfaI CTAG 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 66
BfuI GTATCC 2 cut(s) 16, 281
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 298
BsaAI YACGTR 1 cut(s) 142
BsaHI GRCGYC 1 cut(s) 159
BseBI CCWGG 1 cut(s) 123
BsgI GTGCAG 1 cut(s) 293
BsmAI GTCTC 1 cut(s) 103
BspMAI CTGCAG 1 cut(s) 70
BssNI GRCGYC 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 123
Bst4CI ACNGT 1 cut(s) 185
BstACI GRCGYC 1 cut(s) 159
BstBAI YACGTR 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 293
BstMAI GTCTC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 286
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 66
BstXI CCANNNNNNTGG 1 cut(s) 49
BsuI GTATCC 2 cut(s) 16, 281
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 2 cut(s) 116, 151
CviJI RGCY 5 cut(s) 82, 98, 197, 204, 231
CviKI_1 RGCY 5 cut(s) 82, 98, 197, 204, 231
DdeI CTNAG 1 cut(s) 293
Eco72I CACGTG 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 2 cut(s) 119, 154
FaiI YATR 4 cut(s) 17, 117, 152, 225
FatI CATG 2 cut(s) 115, 150
FspBI CTAG 1 cut(s) 99
Hin1I GRCGYC 1 cut(s) 159
Hin1II CATG 2 cut(s) 119, 154
HinfI GANTC 1 cut(s) 243
HphI GGTGA 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 248
HpyAV CCTTC 2 cut(s) 13, 98
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4IV ACGT 2 cut(s) 141, 159
HpyCH4V TGCA 4 cut(s) 68, 191, 280, 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 286
HpyF3I CTNAG 1 cut(s) 293
HpySE526I ACGT 2 cut(s) 141, 159
Hsp92I GRCGYC 1 cut(s) 159
Hsp92II CATG 2 cut(s) 119, 154
LpnPI CCDG 3 cut(s) 108, 135, 148
LweI GCATC 1 cut(s) 298
MaeI CTAG 1 cut(s) 99
MaeII ACGT 2 cut(s) 141, 159
MaeIII GTNAC 1 cut(s) 233
MluCI AATT 2 cut(s) 37, 263
MnlI CCTC 2 cut(s) 25, 127
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 286
NlaIII CATG 2 cut(s) 119, 154
NmuCI GTSAC 1 cut(s) 233
PfeI GAWTC 1 cut(s) 243
PfoI TCCNGGA 1 cut(s) 121
PmaCI CACGTG 1 cut(s) 142
PmlI CACGTG 1 cut(s) 142
Ppu21I YACGTR 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 121
PspCI CACGTG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 121
PstI CTGCAG 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 123
SetI ASST 5 cut(s) 36, 100, 144, 162, 233
SfaNI GCATC 1 cut(s) 298
SfcI CTRYAG 1 cut(s) 66
Sse9I AATT 2 cut(s) 37, 263
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 121
TaaI ACNGT 1 cut(s) 185
TaiI ACGT 2 cut(s) 144, 162
TasI AATT 2 cut(s) 37, 263
TfiI GAWTC 1 cut(s) 243
TscAI CASTG 1 cut(s) 75
TseFI GTSAC 1 cut(s) 233
Tsp45I GTSAC 1 cut(s) 233
TspDTI ATGAA 2 cut(s) 32, 167
TspRI CASTG 1 cut(s) 75
XapI RAATTY 2 cut(s) 37, 263
XspI CTAG 1 cut(s) 99
ZraI GACGTC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.