RchiOBHm_Chr4g0410121

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
33800936 .. 33802043
1108 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 654 bp
ATGGCTTCATTATTCCCACAATTCCTCTCCCATCCTAACCCTCACCTACGAAACCATCTCCTCTCCTCCCAAACCACCAAAAACCCATCACAGCATTACATCCGTATACCACCCAGAAAACACTACTTGTTCGTCACCAAATGCACTGCACCAAACTCTACTCAACCTGATTTCCCAAGTCCAAACTCTGAAACCACCACCAGTGCAGAGAAATTCCCAATCGAAAAGCGAAGGAAATCGGAAATCACCCGAGACAGGAAGTCCTCAACTGGCCTGGAAAAGCCCGAGCCACCGAACTTTGAGATTGGCTGGAAGAGAACCAAAGAGATTCCACTGGAGAAGCCAGTAGGGTATGTCATAGCTGACTTCCTGGAGAAGTTGGAAGGCTTAATGGGGCGAGAATTCGGGTCCAGAGAGTTGCTGGTGAAGGCTGCAGAGATTGTGGCTGAGAGAGCAAGAGAGGAAGCAAAAGTGTTGAGAGATGATGGTAAGGTGGAAGATAGAATGGTGACCGAATTGTTCAGGGTGCTGAAGCTGATGGAGATGGACATGGTTATGGTAAAGGCTGCAGTGAAGGACGAGACTTTGAGTGAGAGGCTTGAGCAGGCTAAAGCAAGGTGCAGGCAAGCTATACTTGTTGCTTTATCGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

217

Amino Acids

24.89

Weight (kDa)

9.3

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 106
AcsI RAATTY 2 cut(s) 212, 401
AcuI CTGAAG 1 cut(s) 551
AfiI CCNNNNNNNGG 1 cut(s) 255
AhdI GACNNNNNGTC 1 cut(s) 259
AjnI CCWGG 2 cut(s) 273, 369
AluBI AGCT 3 cut(s) 362, 535, 629
AluI AGCT 3 cut(s) 362, 535, 629
Alw26I GTCTC 2 cut(s) 246, 575
Ama87I CYCGRG 2 cut(s) 249, 284
AoxI GGCC 1 cut(s) 271
ApeKI GCWGC 2 cut(s) 431, 566
ApoI RAATTY 2 cut(s) 212, 401
AspS9I GGNCC 1 cut(s) 408
AsuHPI GGTGA 5 cut(s) 35, 127, 238, 436, 520
AvaI CYCGRG 2 cut(s) 249, 284
AvaII GGWCC 1 cut(s) 408
BbvI GCAGC 2 cut(s) 418, 553
BccI CCATC 6 cut(s) 39, 63, 94, 479, 532, 538
BciT130I CCWGG 2 cut(s) 275, 371
BcoDI GTCTC 2 cut(s) 246, 575
BfmI CTRYAG 2 cut(s) 432, 567
BisI GCNGC 2 cut(s) 432, 567
BlsI GCNGC 2 cut(s) 433, 568
Bme1390I CCNGG 2 cut(s) 275, 371
Bme18I GGWCC 1 cut(s) 408
BmeRI GACNNNNNGTC 1 cut(s) 259
BmeT110I CYCGRG 2 cut(s) 249, 284
BmgT120I GGNCC 1 cut(s) 408
BmiI GGNNCC 1 cut(s) 409
BmrFI CCNGG 2 cut(s) 275, 371
BpmI CTGGAG 2 cut(s) 356, 392
BpuEI CTTGAG 1 cut(s) 620
Bsc4I CCNNNNNNNGG 1 cut(s) 255
Bse1I ACTGG 4 cut(s) 201, 274, 339, 344
BseBI CCWGG 2 cut(s) 275, 371
BseGI GGATG 2 cut(s) 31, 99
BseLI CCNNNNNNNGG 1 cut(s) 255
BseMII CTCAG 1 cut(s) 438
BseNI ACTGG 4 cut(s) 201, 274, 339, 344
BseRI GAGGAG 2 cut(s) 50, 55
BseXI GCAGC 2 cut(s) 418, 553
BsgI GTGCAG 3 cut(s) 132, 225, 640
BshFI GGCC 1 cut(s) 273
BsiHKCI CYCGRG 2 cut(s) 249, 284
BslI CCNNNNNNNGG 1 cut(s) 255
BsmAI GTCTC 2 cut(s) 246, 575
BsnI GGCC 1 cut(s) 273
BsoBI CYCGRG 2 cut(s) 249, 284
BspANI GGCC 1 cut(s) 273
BspCNI CTCAG 1 cut(s) 439
BspLI GGNNCC 1 cut(s) 409
BspMAI CTGCAG 2 cut(s) 436, 571
BsrI ACTGG 4 cut(s) 201, 274, 339, 344
BssNAI GTATAC 1 cut(s) 107
Bst1107I GTATAC 1 cut(s) 107
Bst2UI CCWGG 2 cut(s) 275, 371
Bst6I CTCTTC 1 cut(s) 308
BstC8I GCNNGC 3 cut(s) 606, 623, 627
BstDEI CTNAG 1 cut(s) 447
BstEII GGTNACC 1 cut(s) 508
BstF5I GGATG 2 cut(s) 31, 99
BstMAI GTCTC 2 cut(s) 246, 575
BstMWI GCNNNNNNNGC 1 cut(s) 452
BstNI CCWGG 2 cut(s) 275, 371
BstPI GGTNACC 1 cut(s) 508
BstSCI CCNGG 2 cut(s) 273, 369
BstSFI CTRYAG 2 cut(s) 432, 567
BstV1I GCAGC 2 cut(s) 418, 553
BstZ17I GTATAC 1 cut(s) 107
BsuRI GGCC 1 cut(s) 273
BtsCI GGATG 2 cut(s) 31, 99
BtsI GCAGTG 2 cut(s) 144, 576
BtsIMutI CAGTG 4 cut(s) 144, 208, 332, 576
Cac8I GCNNGC 3 cut(s) 606, 623, 627
Cfr13I GGNCC 1 cut(s) 408
CviAII CATG 1 cut(s) 550
DdeI CTNAG 1 cut(s) 447
DriI GACNNNNNGTC 1 cut(s) 259
Eam1104I CTCTTC 1 cut(s) 308
Eam1105I GACNNNNNGTC 1 cut(s) 259
EarI CTCTTC 1 cut(s) 308
Eco47I GGWCC 1 cut(s) 408
Eco57I CTGAAG 1 cut(s) 551
Eco88I CYCGRG 2 cut(s) 249, 284
Eco91I GGTNACC 1 cut(s) 508
EcoO65I GGTNACC 1 cut(s) 508
EcoRI GAATTC 1 cut(s) 401
EcoRII CCWGG 2 cut(s) 273, 369
FaeI CATG 1 cut(s) 553
FaiI YATR 6 cut(s) 107, 354, 359, 551, 557, 632
FalI AAGNNNNNCTT 2 cut(s) 618, 650
FatI CATG 1 cut(s) 549
FblI GTMKAC 1 cut(s) 106
Fnu4HI GCNGC 2 cut(s) 432, 567
FokI GGATG 2 cut(s) 18, 86
Fsp4HI GCNGC 2 cut(s) 432, 567
GluI GCNGC 2 cut(s) 432, 567
GsuI CTGGAG 2 cut(s) 356, 392
HaeIII GGCC 1 cut(s) 273
Hin1II CATG 1 cut(s) 553
HinfI GANTC 1 cut(s) 328
HphI GGTGA 5 cut(s) 35, 127, 238, 436, 520
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 190, 241
Hpy188III TCNNGA 1 cut(s) 411
Hpy8I GTNNAC 1 cut(s) 107
HpyAV CCTTC 4 cut(s) 225, 377, 421, 568
HpyCH4V TGCA 6 cut(s) 144, 149, 206, 434, 569, 621
HpyF10VI GCNNNNNNNGC 1 cut(s) 452
HpyF3I CTNAG 1 cut(s) 447
Hsp92II CATG 1 cut(s) 553
Lsp1109I GCAGC 2 cut(s) 418, 553
MaeIII GTNAC 2 cut(s) 133, 508
MboII GAAGA 2 cut(s) 325, 509
MluCI AATT 4 cut(s) 20, 212, 401, 515
MmeI TCCRAC 1 cut(s) 360
MnlI CCTC 7 cut(s) 35, 51, 71, 76, 274, 454, 588
MseI TTAA 1 cut(s) 389
MslI CAYNNNNRTG 1 cut(s) 554
MspR9I CCNGG 2 cut(s) 275, 371
MvaI CCWGG 2 cut(s) 275, 371
MwoI GCNNNNNNNGC 1 cut(s) 452
NlaIII CATG 1 cut(s) 553
NlaIV GGNNCC 1 cut(s) 409
NmuCI GTSAC 2 cut(s) 133, 508
PfeI GAWTC 1 cut(s) 328
PfoI TCCNGGA 1 cut(s) 369
PkrI GCNGC 2 cut(s) 433, 568
Psp6I CCWGG 2 cut(s) 273, 369
PspEI GGTNACC 1 cut(s) 508
PspGI CCWGG 2 cut(s) 273, 369
PspN4I GGNNCC 1 cut(s) 409
PspPI GGNCC 1 cut(s) 408
PstI CTGCAG 2 cut(s) 436, 571
RseI CAYNNNNRTG 1 cut(s) 554
SaqAI TTAA 1 cut(s) 389
SatI GCNGC 2 cut(s) 432, 567
Sau96I GGNCC 1 cut(s) 408
ScrFI CCNGG 2 cut(s) 275, 371
SetI ASST 7 cut(s) 48, 169, 364, 495, 537, 620, 631
SfcI CTRYAG 2 cut(s) 432, 567
SinI GGWCC 1 cut(s) 408
SmiMI CAYNNNNRTG 1 cut(s) 554
SmlI CTYRAG 1 cut(s) 599
SmoI CTYRAG 1 cut(s) 599
Sse9I AATT 4 cut(s) 20, 212, 401, 515
StyD4I CCNGG 2 cut(s) 273, 369
TaqI TCGA 1 cut(s) 222
TaqII GACCGA 1 cut(s) 527
TasI AATT 4 cut(s) 20, 212, 401, 515
TfiI GAWTC 1 cut(s) 328
Tru1I TTAA 1 cut(s) 389
Tru9I TTAA 1 cut(s) 389
TscAI CASTG 4 cut(s) 151, 208, 339, 576
TseFI GTSAC 2 cut(s) 133, 508
TseI GCWGC 2 cut(s) 431, 566
Tsp45I GTSAC 2 cut(s) 133, 508
TspGWI ACGGA 1 cut(s) 92
TspRI CASTG 4 cut(s) 151, 208, 339, 576
VpaK11BI GGWCC 1 cut(s) 408
XapI RAATTY 2 cut(s) 212, 401
XcmI CCANNNNNNNNNTGG 1 cut(s) 418
XmiI GTMKAC 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.