RchiOBHm_Chr4g0411071

Epimerase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
34851946 .. 34853247
1302 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGGTTGTTGCACTAAAATCGAACTTTCTTCTATTCCAAAATTGGAATGCAGATAATCATAGTGTGCATGTCTTGACACGGTTTAGATCAAAGGCTGAGTTAATTGTTCCGGGTAAGAAGCTGGGAACTTTCCAGGAATCGTAA

Protein Analysis

47

Amino Acids

5.37

Weight (kDa)

9.99

Isoelectric Point (pI)

20.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018374)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
AsuC2I CCSGG 1 cut(s) 111
BcgI CGANNNNNNTGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 134
BcnI CCSGG 1 cut(s) 111
Bme1390I CCNGG 2 cut(s) 111, 134
BmrFI CCNGG 2 cut(s) 111, 134
BpuMI CCSGG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 87
BseYI CCCAGC 1 cut(s) 121
BsiSI CCGG 1 cut(s) 110
BsmI GAATGC 1 cut(s) 52
Bsp143I GATC 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 88
BssMI GATC 1 cut(s) 86
Bst2UI CCWGG 1 cut(s) 134
Bst4CI ACNGT 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 96
BstKTI GATC 1 cut(s) 89
BstMBI GATC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 134
BstNSI RCATGY 1 cut(s) 71
BstSCI CCNGG 2 cut(s) 109, 132
CviAII CATG 1 cut(s) 68
CviJI RGCY 2 cut(s) 95, 121
CviKI_1 RGCY 2 cut(s) 95, 121
DdeI CTNAG 1 cut(s) 96
DpnI GATC 1 cut(s) 88
DpnII GATC 1 cut(s) 86
EcoRII CCWGG 1 cut(s) 132
FaeI CATG 1 cut(s) 71
FaiI YATR 2 cut(s) 60, 69
FatI CATG 1 cut(s) 67
GsaI CCCAGC 1 cut(s) 125
HapII CCGG 1 cut(s) 110
Hin1II CATG 1 cut(s) 71
HinfI GANTC 1 cut(s) 137
HpaII CCGG 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 81
HpyCH4V TGCA 3 cut(s) 11, 50, 67
HpyF3I CTNAG 1 cut(s) 96
Hsp92II CATG 1 cut(s) 71
Kzo9I GATC 1 cut(s) 86
LpnPI CCDG 3 cut(s) 107, 119, 123
MalI GATC 1 cut(s) 88
MboI GATC 1 cut(s) 86
MboII GAAGA 1 cut(s) 20
MluCI AATT 2 cut(s) 40, 102
MseI TTAA 1 cut(s) 101
MspI CCGG 1 cut(s) 110
MspR9I CCNGG 2 cut(s) 111, 134
Mva1269I GAATGC 1 cut(s) 52
MvaI CCWGG 1 cut(s) 134
NciI CCSGG 1 cut(s) 111
NdeII GATC 1 cut(s) 86
NlaIII CATG 1 cut(s) 71
NspI RCATGY 1 cut(s) 71
PctI GAATGC 1 cut(s) 52
PfeI GAWTC 1 cut(s) 137
PfoI TCCNGGA 1 cut(s) 132
Psp6I CCWGG 1 cut(s) 132
PspFI CCCAGC 1 cut(s) 121
PspGI CCWGG 1 cut(s) 132
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 1 cut(s) 86
ScrFI CCNGG 2 cut(s) 111, 134
SetI ASST 1 cut(s) 123
SgeI CNNG 6 cut(s) 80, 85, 90, 122, 123, 134
Sse9I AATT 2 cut(s) 40, 102
StyD4I CCNGG 2 cut(s) 109, 132
TaaI ACNGT 1 cut(s) 81
TaqI TCGA 1 cut(s) 20
TasI AATT 2 cut(s) 40, 102
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
XceI RCATGY 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.