RchiOBHm_Chr5g0026021

Epimerase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
19998793 .. 20000289
1497 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30562

Sequence Viewer

Length: 150 bp
ATGTCTATGGTTGTTGCACTAAAATCGAACTTTCTTCTATTCCAAAATTGGAATGCAGATAATCATAGTGTGCATGTCTTGACACGGTCTAGATCAAAGGCTGAGTTAATTGTTCCGGGTAAGAAGTCGGGAACTTTCCAGGAATCGTAA

Protein Analysis

49

Amino Acids

5.5

Weight (kDa)

9.99

Isoelectric Point (pI)

43.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018374)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 138
AsuC2I CCSGG 1 cut(s) 117
BcgI CGANNNNNNTGC 2 cut(s) 6, 40
BciT130I CCWGG 1 cut(s) 140
BcnI CCSGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 90
Bme1390I CCNGG 2 cut(s) 117, 140
BmrFI CCNGG 2 cut(s) 117, 140
BpuMI CCSGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 140
BseMII CTCAG 1 cut(s) 93
BsiSI CCGG 1 cut(s) 116
BsmI GAATGC 1 cut(s) 58
Bsp143I GATC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 94
BssMI GATC 1 cut(s) 92
Bst2UI CCWGG 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 1 cut(s) 95
BstMBI GATC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 140
BstNSI RCATGY 1 cut(s) 77
BstSCI CCNGG 2 cut(s) 115, 138
CviAII CATG 1 cut(s) 74
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 94
DpnII GATC 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 77
FaiI YATR 3 cut(s) 8, 66, 75
FatI CATG 1 cut(s) 73
FspBI CTAG 1 cut(s) 90
HapII CCGG 1 cut(s) 116
Hin1II CATG 1 cut(s) 77
HinfI GANTC 1 cut(s) 143
HpaII CCGG 1 cut(s) 116
Hpy188III TCNNGA 3 cut(s) 79, 90, 129
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4V TGCA 3 cut(s) 17, 56, 73
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 1 cut(s) 77
Kzo9I GATC 1 cut(s) 92
LpnPI CCDG 2 cut(s) 125, 129
MaeI CTAG 1 cut(s) 90
MalI GATC 1 cut(s) 94
MboI GATC 1 cut(s) 92
MboII GAAGA 1 cut(s) 26
MluCI AATT 2 cut(s) 46, 108
MseI TTAA 1 cut(s) 107
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 2 cut(s) 117, 140
Mva1269I GAATGC 1 cut(s) 58
MvaI CCWGG 1 cut(s) 140
NciI CCSGG 1 cut(s) 117
NdeII GATC 1 cut(s) 92
NlaIII CATG 1 cut(s) 77
NspI RCATGY 1 cut(s) 77
PctI GAATGC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 143
PflFI GACNNNGTC 1 cut(s) 85
PfoI TCCNGGA 1 cut(s) 138
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PsyI GACNNNGTC 1 cut(s) 85
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 92
ScrFI CCNGG 2 cut(s) 117, 140
SgeI CNNG 7 cut(s) 86, 91, 96, 102, 128, 129, 141
Sse9I AATT 2 cut(s) 46, 108
SspMI CTAG 1 cut(s) 90
StyD4I CCNGG 2 cut(s) 115, 138
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 26
TasI AATT 2 cut(s) 46, 108
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
Tth111I GACNNNGTC 1 cut(s) 85
XbaI TCTAGA 1 cut(s) 89
XceI RCATGY 1 cut(s) 77
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.