Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0018989

Physical Location & Seq

Genomic Coordinates Forward (+)

2252375 .. 2253119

Gene Structure 745 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 159 bp

ATGATGTTTCTAGAGTTGATATGTTTTTATAGTATGAAAGAATCTGGATATTTGCCTACTGCTTCTACCTACACCAAACTGATGCAGCAGCTCTTCAATGTGAATGAGTATCAAAAAGGTTGTGACCTGTATGATGTGATACTTGAAACAGGAGTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PPR_3

Protein Analysis

52

Amino Acids

6.07

Weight (kDa)

4.36

Isoelectric Point (pI)

28.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018989)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0450911
rosa_multiflora	Rmu_sc0002621.1_g000011 Rmu_sc0002899.1_g000003
rosa_roxburghii	Rroxscaffold_3G00224570
rosa_samantha	Rh1AG112200 Rh1DG117600 Rh3BG033200 Rh3BG134300 Rh3DG033000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	97, 146
AluBI	AGCT	1 cut(s)	91
AluI	AGCT	1 cut(s)	91
ApeKI	GCWGC	2 cut(s)	85, 88
BbvI	GCAGC	2 cut(s)	97, 100
BfaI	CTAG	1 cut(s)	11
BisI	GCNGC	2 cut(s)	86, 89
BlsI	GCNGC	2 cut(s)	87, 90
BmsI	GCATC	1 cut(s)	72
BseXI	GCAGC	2 cut(s)	97, 100
BspQI	GCTCTTC	1 cut(s)	98
Bst6I	CTCTTC	1 cut(s)	98
BstV1I	GCAGC	2 cut(s)	97, 100
CviJI	RGCY	1 cut(s)	91
CviKI_1	RGCY	1 cut(s)	91
Eam1104I	CTCTTC	1 cut(s)	98
EarI	CTCTTC	1 cut(s)	98
FaiI	YATR	4 cut(s)	22, 30, 35, 132
Fnu4HI	GCNGC	2 cut(s)	86, 89
Fsp4HI	GCNGC	2 cut(s)	86, 89
FspBI	CTAG	1 cut(s)	11
FspEI	CC	7 cut(s)	30, 69, 82, 88, 102, 135, 140
GluI	GCNGC	2 cut(s)	86, 89
HinfI	GANTC	1 cut(s)	41
Hpy188III	TCNNGA	2 cut(s)	11, 45
HpyCH4V	TGCA	1 cut(s)	85
LguI	GCTCTTC	1 cut(s)	98
LpnPI	CCDG	3 cut(s)	30, 135, 140
Lsp1109I	GCAGC	2 cut(s)	97, 100
LweI	GCATC	1 cut(s)	72
MaeI	CTAG	1 cut(s)	11
MaeIII	GTNAC	1 cut(s)	122
MboII	GAAGA	1 cut(s)	85
NmuCI	GTSAC	1 cut(s)	122
PciSI	GCTCTTC	1 cut(s)	98
PfeI	GAWTC	1 cut(s)	41
PkrI	GCNGC	2 cut(s)	87, 90
SapI	GCTCTTC	1 cut(s)	98
SatI	GCNGC	2 cut(s)	86, 89
SetI	ASST	4 cut(s)	71, 93, 121, 129
SfaNI	GCATC	1 cut(s)	72
SgeI	CNNG	4 cut(s)	23, 57, 139, 155
SspMI	CTAG	1 cut(s)	11
TfiI	GAWTC	1 cut(s)	41
TseFI	GTSAC	1 cut(s)	122
TseI	GCWGC	2 cut(s)	85, 88
Tsp45I	GTSAC	1 cut(s)	122
TspDTI	ATGAA	1 cut(s)	50
XbaI	TCTAGA	1 cut(s)	10
XspI	CTAG	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.