Rroxscaffold_3G00224570

pentatricopeptide repeat-containing protein At5g06400

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
7758608 .. 7761254
2647 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00224570.1

Sequence Viewer

Length: 201 bp
ATGAAGAAAAGAGATTTTGTTGATAAGAATGTTTATGGGATTATAATGTTTCTAGAGTTGATATGTTTTTATAGTATGAAAGAATCTGGATATTTGCCAACTGCTTCTACCTACACCAAACTGACGCAGCAGCTCTTCAATGCGAATGAGTATCAGAAAGGCTGTGACCTGTATGATGTCATACTTGAAAGAGGAGTGTAA

Protein Analysis

66

Amino Acids

7.74

Weight (kDa)

6.12

Isoelectric Point (pI)

21.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018989)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 44
AgsI TTSAA 2 cut(s) 139, 188
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
ApeKI GCWGC 2 cut(s) 127, 130
BbvI GCAGC 2 cut(s) 139, 142
BfaI CTAG 1 cut(s) 53
BisI GCNGC 2 cut(s) 128, 131
BlsI GCNGC 2 cut(s) 129, 132
BseXI GCAGC 2 cut(s) 139, 142
BspQI GCTCTTC 1 cut(s) 140
Bst6I CTCTTC 1 cut(s) 140
BstV1I GCAGC 2 cut(s) 139, 142
CseI GACGC 1 cut(s) 133
CviJI RGCY 2 cut(s) 133, 162
CviKI_1 RGCY 2 cut(s) 133, 162
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
FaiI YATR 7 cut(s) 36, 44, 64, 72, 77, 174, 182
Fnu4HI GCNGC 2 cut(s) 128, 131
Fsp4HI GCNGC 2 cut(s) 128, 131
FspBI CTAG 1 cut(s) 53
FspEI CC 9 cut(s) 21, 22, 72, 111, 124, 130, 144, 177, 182
GluI GCNGC 2 cut(s) 128, 131
HgaI GACGC 1 cut(s) 133
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 2 cut(s) 53, 87
LguI GCTCTTC 1 cut(s) 140
LpnPI CCDG 2 cut(s) 72, 182
Lsp1109I GCAGC 2 cut(s) 139, 142
MaeI CTAG 1 cut(s) 53
MaeIII GTNAC 1 cut(s) 164
MboII GAAGA 2 cut(s) 16, 127
MnlI CCTC 1 cut(s) 185
NmuCI GTSAC 1 cut(s) 164
PciSI GCTCTTC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 2 cut(s) 129, 132
PsiI TTATAA 1 cut(s) 44
SapI GCTCTTC 1 cut(s) 140
SatI GCNGC 2 cut(s) 128, 131
SetI ASST 3 cut(s) 113, 135, 171
SgeI CNNG 4 cut(s) 65, 99, 181, 197
SspMI CTAG 1 cut(s) 53
TfiI GAWTC 1 cut(s) 83
TseFI GTSAC 1 cut(s) 164
TseI GCWGC 2 cut(s) 127, 130
Tsp45I GTSAC 1 cut(s) 164
TspDTI ATGAA 2 cut(s) 17, 92
XbaI TCTAGA 1 cut(s) 52
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.