RchiOBHm_Chr3g0486691

Alpha-1,3 1,6-mannosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
33538406 .. 33540417
2012 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGAAAAAGAATATAGACTTGGCGATTTCAGCTTTTGCCATGCTTCGCACCCTTGAAGGAGATGTGCTTCATGGTCTTAATCTGGCTGAAGCTTCCTTGACAATTGCAGGTAAGTTCCTACTTATTTTCTGTCCAACTGATCTTATTGATCGAGACCTCATATTAACTAGTAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.37

Weight (kDa)

5.55

Isoelectric Point (pI)

26.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 98
AcuI CTGAAG 1 cut(s) 108
AgsI TTSAA 1 cut(s) 56
AhlI ACTAGT 1 cut(s) 167
AjuI GAANNNNNNNTTGG 1 cut(s) 34
AluBI AGCT 2 cut(s) 32, 92
AluI AGCT 2 cut(s) 32, 92
Alw26I GTCTC 1 cut(s) 147
BcoDI GTCTC 1 cut(s) 147
BcuI ACTAGT 1 cut(s) 167
BfaI CTAG 1 cut(s) 168
BfuAI ACCTGC 1 cut(s) 98
BsaI GGTCTC 1 cut(s) 147
BsmAI GTCTC 1 cut(s) 147
Bso31I GGTCTC 1 cut(s) 147
Bsp143I GATC 2 cut(s) 139, 148
BspMI ACCTGC 1 cut(s) 98
BspTNI GGTCTC 1 cut(s) 147
BssMI GATC 2 cut(s) 139, 148
BstKTI GATC 2 cut(s) 142, 151
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 2 cut(s) 139, 148
BstMWI GCNNNNNNNGC 1 cut(s) 29
BveI ACCTGC 1 cut(s) 98
CviAII CATG 2 cut(s) 40, 71
CviJI RGCY 3 cut(s) 32, 86, 92
CviKI_1 RGCY 3 cut(s) 32, 86, 92
DpnI GATC 2 cut(s) 141, 150
DpnII GATC 2 cut(s) 139, 148
Eco31I GGTCTC 1 cut(s) 147
Eco57I CTGAAG 1 cut(s) 108
FaeI CATG 2 cut(s) 43, 74
FaiI YATR 4 cut(s) 14, 41, 72, 161
FatI CATG 2 cut(s) 39, 70
FspBI CTAG 1 cut(s) 168
Hin1II CATG 2 cut(s) 43, 74
HindIII AAGCTT 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 50
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
Hsp92II CATG 2 cut(s) 43, 74
Kzo9I GATC 2 cut(s) 139, 148
LpnPI CCDG 2 cut(s) 68, 93
MaeI CTAG 1 cut(s) 168
MalI GATC 2 cut(s) 141, 150
MboI GATC 2 cut(s) 139, 148
MfeI CAATTG 1 cut(s) 102
MluCI AATT 1 cut(s) 102
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 1 cut(s) 167
MseI TTAA 2 cut(s) 78, 164
MunI CAATTG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeII GATC 2 cut(s) 139, 148
NlaIII CATG 2 cut(s) 43, 74
SaqAI TTAA 2 cut(s) 78, 164
Sau3AI GATC 2 cut(s) 139, 148
SetI ASST 4 cut(s) 34, 94, 112, 159
SgeI CNNG 8 cut(s) 31, 52, 65, 83, 95, 109, 120, 164
SpeI ACTAGT 1 cut(s) 167
Sse9I AATT 1 cut(s) 102
SspMI CTAG 1 cut(s) 168
TaqI TCGA 1 cut(s) 151
TasI AATT 1 cut(s) 102
Tru1I TTAA 2 cut(s) 78, 164
Tru9I TTAA 2 cut(s) 78, 164
TspDTI ATGAA 2 cut(s) 17, 59
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.