Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0017425

Physical Location & Seq

Genomic Coordinates Reverse (-)

3132660 .. 3134728

Gene Structure 2069 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ46395

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

ATGGCCGCCATATATATAGATGTTAAATCCCTCGGTCAATCTTCAGTCTCTCTCTCGAGAACTTCTCTTCAGCCGCTCTCTCTCTTCTCTCGCCCTCTCATTCTTCTCTTCGTCAATCCTTTCAATTTTCTCATCGCCATAGAGAATTCGAGATCCCCAAGGACTAGATCGATCAAGGTCACGAGGCTAAGGTCTCGGTTGGGTCATGAAGACCAGATCGATGGCCATGGATCTGAGCGGGATAGTGAAGGAGATTCTCTCGGTCGAAGGCAAGGATCTGTAGGATCTTCATCGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

98

Amino Acids

10.76

Weight (kDa)

10.69

Isoelectric Point (pI)

75.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017425)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0088641 RchiOBHm_Chr2g0173931 RchiOBHm_Chr3g0486691 RchiOBHm_Chr4g0402621
rosa_roxburghii	Rroxscaffold_1G00003230 Rroxscaffold_1G00019760 Rroxscaffold_2G00112610 Rroxscaffold_3G00223310 Rroxscaffold_3G00273670
rosa_rugosa	Rorug06G0360700.1
rosa_samantha	Rh4BG248900 Rh6BG480300 Rh6CG486000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	2 cut(s)	76, 238
AciI	CCGC	3 cut(s)	6, 74, 238
AclWI	GGATC	4 cut(s)	147, 238, 283, 292
AcoI	YGGCCR	2 cut(s)	3, 223
AcsI	RAATTY	1 cut(s)	145
AcuI	CTGAAG	2 cut(s)	27, 53
AgsI	TTSAA	1 cut(s)	124
Alw26I	GTCTC	2 cut(s)	52, 198
AlwI	GGATC	4 cut(s)	147, 238, 283, 292
Ama87I	CYCGRG	1 cut(s)	55
AoxI	GGCC	2 cut(s)	3, 223
ApoI	RAATTY	1 cut(s)	145
AvaI	CYCGRG	1 cut(s)	55
BalI	TGGCCA	1 cut(s)	225
BauI	CACGAG	1 cut(s)	181
BbsI	GAAGAC	1 cut(s)	216
BccI	CCATC	1 cut(s)	215
BcoDI	GTCTC	2 cut(s)	52, 198
BfaI	CTAG	1 cut(s)	165
BfmI	CTRYAG	1 cut(s)	279
BisI	GCNGC	2 cut(s)	6, 74
BlsI	GCNGC	2 cut(s)	7, 75
BmeT110I	CYCGRG	1 cut(s)	55
BpiI	GAAGAC	1 cut(s)	216
BplI	GAGNNNNNCTC	4 cut(s)	49, 81, 243, 275
Bpu10I	CCTNAGC	1 cut(s)	188
Bsa29I	ATCGAT	2 cut(s)	170, 219
BsaBI	GATNNNNATC	1 cut(s)	289
BsaI	GGTCTC	1 cut(s)	198
BsaJI	CCNNGG	3 cut(s)	31, 158, 226
Bse8I	GATNNNNATC	1 cut(s)	289
BseCI	ATCGAT	2 cut(s)	170, 219
BseDI	CCNNGG	3 cut(s)	31, 158, 226
BseJI	GATNNNNATC	1 cut(s)	289
BseMII	CTCAG	1 cut(s)	225
Bsh1285I	CGRYCG	1 cut(s)	265
BshFI	GGCC	2 cut(s)	5, 225
BshVI	ATCGAT	2 cut(s)	170, 219
BsiEI	CGRYCG	1 cut(s)	265
BsiHKCI	CYCGRG	1 cut(s)	55
BsmAI	GTCTC	2 cut(s)	52, 198
BsnI	GGCC	2 cut(s)	5, 225
Bso31I	GGTCTC	1 cut(s)	198
BsoBI	CYCGRG	1 cut(s)	55
Bsp143I	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
Bsp19I	CCATGG	1 cut(s)	226
BspACI	CCGC	3 cut(s)	6, 74, 238
BspANI	GGCC	2 cut(s)	5, 225
BspCNI	CTCAG	1 cut(s)	226
BspDI	ATCGAT	2 cut(s)	170, 219
BspHI	TCATGA	1 cut(s)	205
BspPI	GGATC	4 cut(s)	147, 238, 283, 292
BspTNI	GGTCTC	1 cut(s)	198
BsrBI	CCGCTC	2 cut(s)	76, 238
BssECI	CCNNGG	3 cut(s)	31, 158, 226
BssMI	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
BssSI	CACGAG	1 cut(s)	181
BssT1I	CCWWGG	2 cut(s)	158, 226
Bst2BI	CACGAG	1 cut(s)	181
Bst6I	CTCTTC	3 cut(s)	72, 89, 113
BstDEI	CTNAG	2 cut(s)	188, 234
BstDSI	CCRYGG	1 cut(s)	226
BstKTI	GATC	7 cut(s)	155, 170, 174, 219, 233, 278, 287
BstMAI	GTCTC	2 cut(s)	52, 198
BstMBI	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
BstMCI	CGRYCG	1 cut(s)	265
BstSFI	CTRYAG	1 cut(s)	279
BstV2I	GAAGAC	1 cut(s)	216
BstX2I	RGATCY	4 cut(s)	152, 230, 275, 284
BstXI	CCANNNNNNTGG	1 cut(s)	221
BstYI	RGATCY	4 cut(s)	152, 230, 275, 284
Bsu15I	ATCGAT	2 cut(s)	170, 219
BsuRI	GGCC	2 cut(s)	5, 225
BsuTUI	ATCGAT	2 cut(s)	170, 219
BtgI	CCRYGG	1 cut(s)	226
BtgZI	GCGATG	1 cut(s)	118
CciI	TCATGA	1 cut(s)	205
ClaI	ATCGAT	2 cut(s)	170, 219
CviAII	CATG	2 cut(s)	206, 227
CviJI	RGCY	4 cut(s)	5, 73, 187, 225
CviKI_1	RGCY	4 cut(s)	5, 73, 187, 225
DdeI	CTNAG	2 cut(s)	188, 234
DpnI	GATC	7 cut(s)	154, 169, 173, 218, 232, 277, 286
DpnII	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
EaeI	YGGCCR	2 cut(s)	3, 223
Eam1104I	CTCTTC	3 cut(s)	72, 89, 113
EarI	CTCTTC	3 cut(s)	72, 89, 113
Eco130I	CCWWGG	2 cut(s)	158, 226
Eco31I	GGTCTC	1 cut(s)	198
Eco57I	CTGAAG	2 cut(s)	27, 53
Eco88I	CYCGRG	1 cut(s)	55
EcoRI	GAATTC	1 cut(s)	145
EcoT14I	CCWWGG	2 cut(s)	158, 226
ErhI	CCWWGG	2 cut(s)	158, 226
FaeI	CATG	2 cut(s)	209, 230
FaiI	YATR	7 cut(s)	11, 13, 15, 17, 140, 207, 228
FatI	CATG	2 cut(s)	205, 226
FauI	CCCGC	1 cut(s)	231
Fnu4HI	GCNGC	2 cut(s)	6, 74
Fsp4HI	GCNGC	2 cut(s)	6, 74
FspBI	CTAG	1 cut(s)	165
GluI	GCNGC	2 cut(s)	6, 74
HaeIII	GGCC	2 cut(s)	5, 225
Hin1II	CATG	2 cut(s)	209, 230
HinfI	GANTC	1 cut(s)	254
Hpy188I	TCNGA	1 cut(s)	235
Hpy188III	TCNNGA	5 cut(s)	55, 57, 150, 181, 206
HpyAV	CCTTC	2 cut(s)	242, 261
HpyF3I	CTNAG	2 cut(s)	188, 234
Hsp92II	CATG	2 cut(s)	209, 230
Kzo9I	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
LpnPI	CCDG	1 cut(s)	227
MaeI	CTAG	1 cut(s)	165
MaeIII	GTNAC	1 cut(s)	178
MalI	GATC	7 cut(s)	154, 169, 173, 218, 232, 277, 286
MbiI	CCGCTC	2 cut(s)	76, 238
MboI	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
MboII	GAAGA	7 cut(s)	33, 59, 76, 95, 100, 221, 279
MflI	RGATCY	4 cut(s)	152, 230, 275, 284
MlsI	TGGCCA	1 cut(s)	225
MluCI	AATT	2 cut(s)	124, 145
MluNI	TGGCCA	1 cut(s)	225
MnlI	CCTC	3 cut(s)	41, 105, 177
Mox20I	TGGCCA	1 cut(s)	225
MscI	TGGCCA	1 cut(s)	225
MseI	TTAA	1 cut(s)	24
Msp20I	TGGCCA	1 cut(s)	225
NcoI	CCATGG	1 cut(s)	226
NdeII	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
NlaIII	CATG	2 cut(s)	209, 230
NmuCI	GTSAC	1 cut(s)	178
PaeR7I	CTCGAG	1 cut(s)	55
PagI	TCATGA	1 cut(s)	205
PfeI	GAWTC	1 cut(s)	254
PkrI	GCNGC	2 cut(s)	7, 75
PsuI	RGATCY	4 cut(s)	152, 230, 275, 284
SaqAI	TTAA	1 cut(s)	24
SatI	GCNGC	2 cut(s)	6, 74
Sau3AI	GATC	7 cut(s)	152, 167, 171, 216, 230, 275, 284
SetI	ASST	2 cut(s)	180, 194
SfcI	CTRYAG	1 cut(s)	279
Sfr274I	CTCGAG	1 cut(s)	55
SlaI	CTCGAG	1 cut(s)	55
SmlI	CTYRAG	1 cut(s)	55
SmoI	CTYRAG	1 cut(s)	55
Sse9I	AATT	2 cut(s)	124, 145
SsiI	CCGC	3 cut(s)	6, 74, 238
SspMI	CTAG	1 cut(s)	165
StyI	CCWWGG	2 cut(s)	158, 226
TaqI	TCGA	5 cut(s)	56, 149, 170, 219, 265
TaqII	GACCGA	2 cut(s)	23, 251
TasI	AATT	2 cut(s)	124, 145
TauI	GCSGC	2 cut(s)	8, 76
TfiI	GAWTC	1 cut(s)	254
Tru1I	TTAA	1 cut(s)	24
Tru9I	TTAA	1 cut(s)	24
TseFI	GTSAC	1 cut(s)	178
Tsp45I	GTSAC	1 cut(s)	178
TspDTI	ATGAA	2 cut(s)	222, 279
XapI	RAATTY	1 cut(s)	145
XhoI	CTCGAG	1 cut(s)	55
XspI	CTAG	1 cut(s)	165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.