Rh4BG248900

Alpha-1,3 1,6-mannosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
41706607 .. 41707691
1085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG248900.1

Sequence Viewer

Length: 294 bp
ATGTCGAAAGACCTTATCAAAATTGTCAGATTCTTTTATGTTGGTGGAAGGCTGGAAGCTGCTTTAGCAGAGCATGAAATTTCTGGGTTAAATTTTCACTCTATCAACCGTTTTGAGAGGAAAAAGAATATAGACTTGGCGATTTCAGCTTTTGCCATGCTTCGCACCCTTGAAGGAGATGTGCTTCATGGTCTTAATCTGGCTGAAGCTTCCTTGACAATTGCAGGCAAGTTCCTACTTATTTTCTGTCCAACTGATCTTATTGATCGAGACCTCATACTAACTAGTAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.89

Weight (kDa)

6.82

Isoelectric Point (pI)

24.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 78, 91
AcuI CTGAAG 1 cut(s) 225
AgsI TTSAA 1 cut(s) 173
AhlI ACTAGT 1 cut(s) 284
AjuI GAANNNNNNNTTGG 2 cut(s) 119, 151
AluBI AGCT 3 cut(s) 59, 149, 209
AluI AGCT 3 cut(s) 59, 149, 209
Alw26I GTCTC 1 cut(s) 264
ApeKI GCWGC 1 cut(s) 59
ApoI RAATTY 2 cut(s) 78, 91
BbvI GCAGC 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 264
BcuI ACTAGT 1 cut(s) 284
BfaI CTAG 1 cut(s) 285
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BsaI GGTCTC 1 cut(s) 264
BseXI GCAGC 1 cut(s) 46
BsmAI GTCTC 1 cut(s) 264
Bso31I GGTCTC 1 cut(s) 264
Bsp143I GATC 2 cut(s) 256, 265
BspTNI GGTCTC 1 cut(s) 264
BssMI GATC 2 cut(s) 256, 265
Bst4CI ACNGT 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 226
BstKTI GATC 2 cut(s) 259, 268
BstMAI GTCTC 1 cut(s) 264
BstMBI GATC 2 cut(s) 256, 265
BstMWI GCNNNNNNNGC 2 cut(s) 65, 146
BstV1I GCAGC 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 226
CviAII CATG 3 cut(s) 74, 157, 188
CviJI RGCY 5 cut(s) 52, 59, 149, 203, 209
CviKI_1 RGCY 5 cut(s) 52, 59, 149, 203, 209
DpnI GATC 2 cut(s) 258, 267
DpnII GATC 2 cut(s) 256, 265
Eco31I GGTCTC 1 cut(s) 264
Eco57I CTGAAG 1 cut(s) 225
FaeI CATG 3 cut(s) 77, 160, 191
FaiI YATR 6 cut(s) 39, 75, 131, 158, 189, 278
FatI CATG 3 cut(s) 73, 156, 187
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
FspBI CTAG 1 cut(s) 285
GluI GCNGC 1 cut(s) 60
Hin1II CATG 3 cut(s) 77, 160, 191
HindIII AAGCTT 1 cut(s) 207
HinfI GANTC 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 29
Hpy188III TCNNGA 1 cut(s) 269
HpyAV CCTTC 2 cut(s) 42, 167
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 224
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 146
Hsp92II CATG 3 cut(s) 77, 160, 191
Kzo9I GATC 2 cut(s) 256, 265
LpnPI CCDG 4 cut(s) 38, 69, 185, 210
Lsp1109I GCAGC 1 cut(s) 46
MaeI CTAG 1 cut(s) 285
MalI GATC 2 cut(s) 258, 267
MboI GATC 2 cut(s) 256, 265
MfeI CAATTG 1 cut(s) 219
MluCI AATT 4 cut(s) 21, 78, 91, 219
MmeI TCCRAC 1 cut(s) 275
MnlI CCTC 2 cut(s) 111, 284
MseI TTAA 2 cut(s) 89, 195
MunI CAATTG 1 cut(s) 219
MwoI GCNNNNNNNGC 2 cut(s) 65, 146
NdeII GATC 2 cut(s) 256, 265
NlaIII CATG 3 cut(s) 77, 160, 191
PfeI GAWTC 1 cut(s) 30
PkrI GCNGC 1 cut(s) 61
SaqAI TTAA 2 cut(s) 89, 195
SatI GCNGC 1 cut(s) 60
Sau3AI GATC 2 cut(s) 256, 265
SetI ASST 5 cut(s) 15, 61, 151, 211, 276
SpeI ACTAGT 1 cut(s) 284
Sse9I AATT 4 cut(s) 21, 78, 91, 219
SspMI CTAG 1 cut(s) 285
TaaI ACNGT 1 cut(s) 110
TaqI TCGA 2 cut(s) 5, 268
TasI AATT 4 cut(s) 21, 78, 91, 219
TfiI GAWTC 1 cut(s) 30
Tru1I TTAA 2 cut(s) 89, 195
Tru9I TTAA 2 cut(s) 89, 195
TseI GCWGC 1 cut(s) 59
TspDTI ATGAA 2 cut(s) 90, 176
XapI RAATTY 2 cut(s) 78, 91
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.