RchiOBHm_Chr2g0090511

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
4346838 .. 4347458
621 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGTCTCTTGGCCCATTGATGTTCAGGTCACTGGTGAGGCTACTAACATCACTGATTCGTGATCCGGCTGCTTCAATCTCAACCCTGCTCTTCTACAGTGAGCTTCTACCTCAGAATATCGTGCTAGAAAGATTAGTTCGACATGAATTGCTTGACCAAGAAAACTATTTGTTCCACTTCCTGGTCAACTTTTTGAGATGTTTTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.21

Weight (kDa)

6.71

Isoelectric Point (pI)

48.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016724)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 181
AclWI GGATC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 181
AgsI TTSAA 1 cut(s) 75
AjnI CCWGG 1 cut(s) 180
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 56
AoxI GGCC 1 cut(s) 10
ApeKI GCWGC 1 cut(s) 68
AspS9I GGNCC 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 46
BbvI GCAGC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 182
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 1 cut(s) 125
BfmI CTRYAG 1 cut(s) 94
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 55
BshFI GGCC 1 cut(s) 12
BsiSI CCGG 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 181
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 1 cut(s) 12
Bsp143I GATC 1 cut(s) 61
BspANI GGCC 1 cut(s) 12
BspCNI CTCAG 1 cut(s) 124
BspPI GGATC 1 cut(s) 56
BspQI GCTCTTC 1 cut(s) 95
BsrI ACTGG 1 cut(s) 36
BssMI GATC 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 98
Bst6I CTCTTC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 61
BstNI CCWGG 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 180
BstSFI CTRYAG 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 55
BsuRI GGCC 1 cut(s) 12
BtsIMutI CAGTG 3 cut(s) 29, 50, 103
Cfr13I GGNCC 1 cut(s) 11
CviAII CATG 1 cut(s) 143
CviJI RGCY 4 cut(s) 12, 40, 68, 103
CviKI_1 RGCY 4 cut(s) 12, 40, 68, 103
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eam1104I CTCTTC 1 cut(s) 95
EarI CTCTTC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 180
FaeI CATG 1 cut(s) 146
FaiI YATR 1 cut(s) 144
FatI CATG 1 cut(s) 142
Fnu4HI GCNGC 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 69
FspBI CTAG 1 cut(s) 125
GluI GCNGC 1 cut(s) 69
HaeIII GGCC 1 cut(s) 12
HapII CCGG 1 cut(s) 65
Hin1II CATG 1 cut(s) 146
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
HinfI GANTC 1 cut(s) 55
HpaII CCGG 1 cut(s) 65
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 1 cut(s) 114
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 98
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 1 cut(s) 61
LguI GCTCTTC 1 cut(s) 95
LpnPI CCDG 6 cut(s) 10, 17, 78, 98, 167, 194
Lsp1109I GCAGC 1 cut(s) 55
MaeI CTAG 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 27
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 82
MluCI AATT 1 cut(s) 146
MnlI CCTC 2 cut(s) 30, 120
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 182
MvaI CCWGG 1 cut(s) 182
NdeII GATC 1 cut(s) 61
NlaIII CATG 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 27
PciSI GCTCTTC 1 cut(s) 95
PfeI GAWTC 1 cut(s) 55
PflMI CCANNNNNTGG 1 cut(s) 181
PkrI GCNGC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 180
PspGI CCWGG 1 cut(s) 180
PspPI GGNCC 1 cut(s) 11
SapI GCTCTTC 1 cut(s) 95
SatI GCNGC 1 cut(s) 69
Sau3AI GATC 1 cut(s) 61
Sau96I GGNCC 1 cut(s) 11
ScrFI CCNGG 1 cut(s) 182
SetI ASST 3 cut(s) 29, 105, 112
SfcI CTRYAG 1 cut(s) 94
Sse9I AATT 1 cut(s) 146
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 98
TaqI TCGA 1 cut(s) 139
TasI AATT 1 cut(s) 146
TfiI GAWTC 1 cut(s) 55
TscAI CASTG 3 cut(s) 36, 57, 103
TseFI GTSAC 1 cut(s) 27
TseI GCWGC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 27
TspDTI ATGAA 1 cut(s) 159
TspRI CASTG 3 cut(s) 36, 57, 103
Van91I CCANNNNNTGG 1 cut(s) 181
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.