RchiOBHm_Chr2g0118581

Belongs to the universal ribosomal protein uL14 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
30728513 .. 30728689
177 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGATTCAACCTCAAACCCATTTGAACGTAGCGGATAACAGCGGGGCCCAAGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGACGATATGCTCATATTGGTGACGTTATTGTTGCTGTAATCAAAGAAGCAGTACCAAATACACCTCTCGAAAGATCAGAAGTGATCTGA

Protein Analysis

58

Amino Acids

6.35

Weight (kDa)

6.01

Isoelectric Point (pI)

43.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L14 PF00238 1 - 57 9.8e-19 Ribosomal protein L14p/L23e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017165)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 32, 42
AfaI GTAC 1 cut(s) 141
AgsI TTSAA 2 cut(s) 8, 25
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
AoxI GGCC 1 cut(s) 45
ApaI GGGCCC 1 cut(s) 49
AspS9I GGNCC 2 cut(s) 45, 46
AsuHPI GGTGA 1 cut(s) 119
AsuII TTCGAA 1 cut(s) 67
AsuNHI GCTAGC 1 cut(s) 80
BaeGI GKGCMC 1 cut(s) 49
BanII GRGCYC 1 cut(s) 49
BfaI CTAG 1 cut(s) 81
BmgT120I GGNCC 2 cut(s) 45, 46
BmiI GGNNCC 2 cut(s) 46, 47
BmtI GCTAGC 1 cut(s) 84
Bpu14I TTCGAA 1 cut(s) 67
BseSI GKGCMC 1 cut(s) 49
BshFI GGCC 1 cut(s) 47
BsnI GGCC 1 cut(s) 47
Bsp119I TTCGAA 1 cut(s) 67
Bsp120I GGGCCC 1 cut(s) 45
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 2 cut(s) 161, 171
BspACI CCGC 2 cut(s) 32, 42
BspANI GGCC 1 cut(s) 47
BspLI GGNNCC 2 cut(s) 46, 47
BspOI GCTAGC 1 cut(s) 84
BspT104I TTCGAA 1 cut(s) 67
BssMI GATC 2 cut(s) 161, 171
BstBI TTCGAA 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 82
BstKTI GATC 2 cut(s) 164, 174
BstMBI GATC 2 cut(s) 161, 171
BstSLI GKGCMC 1 cut(s) 49
BsuRI GGCC 1 cut(s) 47
Cac8I GCNNGC 1 cut(s) 82
Cfr13I GGNCC 2 cut(s) 45, 46
Csp6I GTAC 1 cut(s) 140
CviJI RGCY 2 cut(s) 47, 80
CviKI_1 RGCY 2 cut(s) 47, 80
CviQI GTAC 1 cut(s) 140
DpnI GATC 2 cut(s) 163, 173
DpnII GATC 2 cut(s) 161, 171
Eco24I GRGCYC 1 cut(s) 49
EcoO109I RGGNCCY 1 cut(s) 45
EcoT38I GRGCYC 1 cut(s) 49
FaiI YATR 3 cut(s) 74, 96, 102
FauI CCCGC 1 cut(s) 35
FriOI GRGCYC 1 cut(s) 49
FspBI CTAG 1 cut(s) 81
HaeIII GGCC 1 cut(s) 47
HinfI GANTC 2 cut(s) 4, 69
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 166, 176
Hpy188III TCNNGA 1 cut(s) 155
Hpy99I CGWCG 1 cut(s) 93
HpyCH4IV ACGT 2 cut(s) 27, 111
HpySE526I ACGT 2 cut(s) 27, 111
Kzo9I GATC 2 cut(s) 161, 171
LmnI GCTCC 1 cut(s) 77
MaeI CTAG 1 cut(s) 81
MaeII ACGT 2 cut(s) 27, 111
MaeIII GTNAC 1 cut(s) 107
MalI GATC 2 cut(s) 163, 173
MboI GATC 2 cut(s) 161, 171
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 1 cut(s) 53
MnlI CCTC 2 cut(s) 21, 162
MslI CAYNNNNRTG 1 cut(s) 105
MspA1I CMGCKG 1 cut(s) 42
NdeII GATC 2 cut(s) 161, 171
NheI GCTAGC 1 cut(s) 80
NlaIV GGNNCC 2 cut(s) 46, 47
NmuCI GTSAC 1 cut(s) 107
NspV TTCGAA 1 cut(s) 67
PfeI GAWTC 2 cut(s) 4, 69
PspN4I GGNNCC 2 cut(s) 46, 47
PspOMI GGGCCC 1 cut(s) 45
PspPI GGNCC 2 cut(s) 45, 46
RsaI GTAC 1 cut(s) 141
RsaNI GTAC 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 105
Sau3AI GATC 2 cut(s) 161, 171
Sau96I GGNCC 2 cut(s) 45, 46
SduI GDGCHC 1 cut(s) 49
SetI ASST 5 cut(s) 13, 30, 82, 114, 154
SfuI TTCGAA 1 cut(s) 67
SgeI CNNG 4 cut(s) 55, 62, 93, 167
SmiMI CAYNNNNRTG 1 cut(s) 105
Sse9I AATT 1 cut(s) 53
SsiI CCGC 2 cut(s) 32, 42
SspMI CTAG 1 cut(s) 81
TaiI ACGT 2 cut(s) 30, 114
TaqI TCGA 3 cut(s) 67, 88, 156
TasI AATT 1 cut(s) 53
TfiI GAWTC 2 cut(s) 4, 69
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.