RchiOBHm_Chr2g0135851

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
53060378 .. 53060626
249 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
ATGGAAATGGAGAAGACGAGAAAGAGTGAGGGCGAGAAGATATGCAAACAAAGTTATAGTCCATCCTCCAACACCACATCCTCATACCGCTTCCATTCTTCTTTCTTCATCAGTTGCCATTATGACGACCAGAAAAGGTATTATGAATTGGGACATGAAGATCAGCCATATGCTACCAAGTTCTATAACTGTTGTGGGGCTGAGGCTCTTGAAGGTTCTGGTTGCAGCACCAGTTTCCATGTTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.42

Weight (kDa)

6.04

Isoelectric Point (pI)

60.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013154)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 88
AgsI TTSAA 1 cut(s) 212
ApeKI GCWGC 1 cut(s) 225
ArsI GACNNNNNNTTYG 2 cut(s) 43, 75
BbsI GAAGAC 1 cut(s) 20
BbvCI CCTCAGC 1 cut(s) 201
BbvI GCAGC 1 cut(s) 237
BccI CCATC 1 cut(s) 70
BisI GCNGC 1 cut(s) 226
BlsI GCNGC 1 cut(s) 227
BpiI GAAGAC 1 cut(s) 20
Bpu10I CCTNAGC 1 cut(s) 201
Bse1I ACTGG 1 cut(s) 231
BseGI GGATG 2 cut(s) 62, 77
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 1 cut(s) 231
BseXI GCAGC 1 cut(s) 237
BslFI GGGAC 1 cut(s) 165
BsmFI GGGAC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 193
BsrI ACTGG 1 cut(s) 231
BssMI GATC 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 191
BstDEI CTNAG 1 cut(s) 201
BstF5I GGATG 2 cut(s) 62, 77
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstV1I GCAGC 1 cut(s) 237
BstV2I GAAGAC 1 cut(s) 20
BtsCI GGATG 2 cut(s) 62, 77
CviAII CATG 2 cut(s) 155, 239
CviJI RGCY 3 cut(s) 166, 200, 206
CviKI_1 RGCY 3 cut(s) 166, 200, 206
DdeI CTNAG 1 cut(s) 201
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
FaeI CATG 2 cut(s) 158, 242
FaqI GGGAC 1 cut(s) 165
FatI CATG 2 cut(s) 154, 238
FauNDI CATATG 1 cut(s) 169
Fnu4HI GCNGC 1 cut(s) 226
FokI GGATG 2 cut(s) 49, 64
Fsp4HI GCNGC 1 cut(s) 226
GluI GCNGC 1 cut(s) 226
Hin1II CATG 2 cut(s) 158, 242
Hpy188III TCNNGA 1 cut(s) 209
HpyAV CCTTC 1 cut(s) 206
HpyCH4III ACNGT 1 cut(s) 191
HpyCH4V TGCA 2 cut(s) 45, 225
HpyF3I CTNAG 1 cut(s) 201
Hsp92II CATG 2 cut(s) 158, 242
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 143, 204, 244
Lsp1109I GCAGC 1 cut(s) 237
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 5 cut(s) 25, 49, 90, 97, 170
MluCI AATT 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 4 cut(s) 22, 76, 91, 196
MseI TTAA 1 cut(s) 247
NdeI CATATG 1 cut(s) 169
NdeII GATC 1 cut(s) 160
NlaIII CATG 2 cut(s) 158, 242
PkrI GCNGC 1 cut(s) 227
SaqAI TTAA 1 cut(s) 247
SatI GCNGC 1 cut(s) 226
Sau3AI GATC 1 cut(s) 160
SetI ASST 2 cut(s) 140, 217
SgeI CNNG 8 cut(s) 30, 46, 142, 167, 190, 221, 231, 243
Sse9I AATT 1 cut(s) 146
SsiI CCGC 1 cut(s) 88
TaaI ACNGT 1 cut(s) 191
TasI AATT 1 cut(s) 146
Tru1I TTAA 1 cut(s) 247
Tru9I TTAA 1 cut(s) 247
TseI GCWGC 1 cut(s) 225
TspDTI ATGAA 3 cut(s) 97, 159, 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.