RchiOBHm_Chr2g0163871

Stress-induced protein KIN2-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
79147996 .. 79148783
788 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGACAACTCCCAAAATGCAGGCTACCAAGCTGGCCAGGCCAAGGGCCAAGCTCAGGAAAAGGCCAGCAACTTGATGGACTCGGCCAGCAATGCTGCCCAATCTGCTAAGGAATCAGCCCAAAATGCTGGTCAGCAAATGCAGCAAAAGGCACAGGGAGCTGCTGATTCAGTCAGGAATGCAATGGGAGGCAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

6.73

Weight (kDa)

8.1

Isoelectric Point (pI)

36.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 34, 84
AfiI CCNNNNNNNGG 2 cut(s) 43, 55
AjnI CCWGG 1 cut(s) 36
AluBI AGCT 3 cut(s) 32, 53, 161
AluI AGCT 3 cut(s) 32, 53, 161
AoxI GGCC 5 cut(s) 34, 39, 46, 63, 84
ApeKI GCWGC 3 cut(s) 95, 142, 161
ArsI GACNNNNNNTTYG 2 cut(s) 115, 147
AspS9I GGNCC 1 cut(s) 46
BalI TGGCCA 1 cut(s) 36
BbvI GCAGC 3 cut(s) 82, 148, 154
BccI CCATC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 38
BisI GCNGC 3 cut(s) 96, 143, 162
BlsI GCNGC 3 cut(s) 97, 144, 163
Bme1390I CCNGG 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 46
BmrFI CCNGG 1 cut(s) 38
Bpu10I CCTNAGC 2 cut(s) 54, 108
BsaJI CCNNGG 1 cut(s) 42
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 55
Bse3DI GCAATG 2 cut(s) 97, 189
BseBI CCWGG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 42
BseLI CCNNNNNNNGG 2 cut(s) 43, 55
BseMI GCAATG 2 cut(s) 97, 189
BseMII CTCAG 1 cut(s) 68
BseXI GCAGC 3 cut(s) 82, 148, 154
BshFI GGCC 5 cut(s) 36, 41, 48, 65, 86
BslI CCNNNNNNNGG 2 cut(s) 43, 55
BsmI GAATGC 1 cut(s) 184
BsnI GGCC 5 cut(s) 36, 41, 48, 65, 86
BspANI GGCC 5 cut(s) 36, 41, 48, 65, 86
BspCNI CTCAG 1 cut(s) 67
BsrDI GCAATG 2 cut(s) 97, 189
BssECI CCNNGG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 38
BstC8I GCNNGC 4 cut(s) 22, 34, 67, 88
BstDEI CTNAG 2 cut(s) 54, 108
BstMWI GCNNNNNNNGC 6 cut(s) 38, 92, 104, 125, 142, 158
BstNI CCWGG 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 36
BstV1I GCAGC 3 cut(s) 82, 148, 154
BstXI CCANNNNNNTGG 1 cut(s) 128
BsuRI GGCC 5 cut(s) 36, 41, 48, 65, 86
Cac8I GCNNGC 4 cut(s) 22, 34, 67, 88
Cfr13I GGNCC 1 cut(s) 46
DdeI CTNAG 2 cut(s) 54, 108
EaeI YGGCCR 2 cut(s) 34, 84
Eco130I CCWWGG 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 42
Fnu4HI GCNGC 3 cut(s) 96, 143, 162
Fsp4HI GCNGC 3 cut(s) 96, 143, 162
GluI GCNGC 3 cut(s) 96, 143, 162
HaeIII GGCC 5 cut(s) 36, 41, 48, 65, 86
HinfI GANTC 3 cut(s) 80, 113, 167
Hpy188III TCNNGA 2 cut(s) 56, 175
HpyCH4V TGCA 3 cut(s) 20, 142, 182
HpyF10VI GCNNNNNNNGC 6 cut(s) 38, 92, 104, 125, 142, 158
HpyF3I CTNAG 2 cut(s) 54, 108
LmnI GCTCC 1 cut(s) 158
Lsp1109I GCAGC 3 cut(s) 82, 148, 154
MlsI TGGCCA 1 cut(s) 36
MluNI TGGCCA 1 cut(s) 36
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 1 cut(s) 182
Mox20I TGGCCA 1 cut(s) 36
MscI TGGCCA 1 cut(s) 36
Msp20I TGGCCA 1 cut(s) 36
MspR9I CCNGG 1 cut(s) 38
Mva1269I GAATGC 1 cut(s) 184
MvaI CCWGG 1 cut(s) 38
MwoI GCNNNNNNNGC 6 cut(s) 38, 92, 104, 125, 142, 158
NmeAIII GCCGAG 1 cut(s) 62
PctI GAATGC 1 cut(s) 184
PfeI GAWTC 2 cut(s) 113, 167
PkrI GCNGC 3 cut(s) 97, 144, 163
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 36
PspGI CCWGG 1 cut(s) 36
PspPI GGNCC 1 cut(s) 46
SatI GCNGC 3 cut(s) 96, 143, 162
Sau96I GGNCC 1 cut(s) 46
SchI GAGTC 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 38
SetI ASST 3 cut(s) 34, 55, 163
StyD4I CCNGG 1 cut(s) 36
StyI CCWWGG 1 cut(s) 42
TfiI GAWTC 2 cut(s) 113, 167
TseI GCWGC 3 cut(s) 95, 142, 161
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.