RchiOBHm_Chr1g0354731

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
47585434 .. 47586096
663 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 333 bp
ATGTCCAATTTAAGACACCTAAAGCTCAACTCCAATGACTTCACCGGGAACAAAATTCCAGAGCTCATTGGTAATCTGACCATTTTAAGATATCTAGATCACTCTAATGCTGTCTTAGGTGGTGAAATTCCACATCATCAGCTTGGAAACCTTACCAGCAGTATCATAAACTCGCTATTACCACTTCTCTCAGGCTGTAGAAAAACCTCAATTGGCTCCCTCGCTTTCTTTAAATTATCTGGACCTGACTTGGGCCGATCTAAGACTTCTGATTGGCTGGAAACAATAGACAAGCTCTCTAATCTCAGAAACTTGACCTCAATGGGGATGTGA

Protein Analysis

110

Amino Acids

12.04

Weight (kDa)

9.36

Isoelectric Point (pI)

26.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020487)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 54, 126
AfiI CCNNNNNNNGG 2 cut(s) 251, 324
AluBI AGCT 4 cut(s) 25, 64, 142, 295
AluI AGCT 4 cut(s) 25, 64, 142, 295
Alw21I GWGCWC 1 cut(s) 66
AoxI GGCC 1 cut(s) 253
ApoI RAATTY 2 cut(s) 54, 126
AspS9I GGNCC 2 cut(s) 242, 253
AsuC2I CCSGG 1 cut(s) 46
AsuHPI GGTGA 2 cut(s) 34, 134
AvaII GGWCC 1 cut(s) 242
BanII GRGCYC 1 cut(s) 66
Bbv12I GWGCWC 1 cut(s) 66
BcnI CCSGG 1 cut(s) 46
BfaI CTAG 1 cut(s) 95
BfmI CTRYAG 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 242
BmgT120I GGNCC 2 cut(s) 242, 253
BmiI GGNNCC 1 cut(s) 217
BmrFI CCNGG 1 cut(s) 46
BpuMI CCSGG 1 cut(s) 46
Bsc4I CCNNNNNNNGG 2 cut(s) 251, 324
BseGI GGATG 1 cut(s) 333
BseLI CCNNNNNNNGG 2 cut(s) 251, 324
BseMII CTCAG 2 cut(s) 204, 319
BshFI GGCC 1 cut(s) 255
BsiHKAI GWGCWC 1 cut(s) 66
BsiSI CCGG 1 cut(s) 45
BslI CCNNNNNNNGG 2 cut(s) 251, 324
BsnI GGCC 1 cut(s) 255
Bsp1286I GDGCHC 1 cut(s) 66
Bsp143I GATC 2 cut(s) 97, 257
BspANI GGCC 1 cut(s) 255
BspCNI CTCAG 2 cut(s) 203, 318
BspLI GGNNCC 1 cut(s) 217
BssMI GATC 2 cut(s) 97, 257
BstDEI CTNAG 4 cut(s) 115, 190, 261, 305
BstF5I GGATG 1 cut(s) 333
BstKTI GATC 2 cut(s) 100, 260
BstMBI GATC 2 cut(s) 97, 257
BstSCI CCNGG 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 196
BsuRI GGCC 1 cut(s) 255
BtsCI GGATG 1 cut(s) 333
Cfr13I GGNCC 2 cut(s) 242, 253
CviJI RGCY 8 cut(s) 25, 64, 142, 195, 216, 255, 277, 295
CviKI_1 RGCY 8 cut(s) 25, 64, 142, 195, 216, 255, 277, 295
DdeI CTNAG 4 cut(s) 115, 190, 261, 305
DpnI GATC 2 cut(s) 99, 259
DpnII GATC 2 cut(s) 97, 257
DraI TTTAAA 1 cut(s) 232
Ecl136II GAGCTC 1 cut(s) 64
Eco24I GRGCYC 1 cut(s) 66
Eco32I GATATC 1 cut(s) 92
Eco47I GGWCC 1 cut(s) 242
Eco53kI GAGCTC 1 cut(s) 64
EcoICRI GAGCTC 1 cut(s) 64
EcoRV GATATC 1 cut(s) 92
EcoT38I GRGCYC 1 cut(s) 66
FaiI YATR 1 cut(s) 167
FriOI GRGCYC 1 cut(s) 66
FspBI CTAG 1 cut(s) 95
HaeIII GGCC 1 cut(s) 255
HapII CCGG 1 cut(s) 45
HpaII CCGG 1 cut(s) 45
HphI GGTGA 2 cut(s) 34, 134
Hpy188I TCNGA 3 cut(s) 78, 271, 308
Hpy188III TCNNGA 3 cut(s) 59, 95, 240
HpyF3I CTNAG 4 cut(s) 115, 190, 261, 305
Kzo9I GATC 2 cut(s) 97, 257
LmnI GCTCC 1 cut(s) 221
LpnPI CCDG 7 cut(s) 58, 72, 169, 177, 225, 258, 263
MaeI CTAG 1 cut(s) 95
MalI GATC 2 cut(s) 99, 259
MboI GATC 2 cut(s) 97, 257
MfeI CAATTG 1 cut(s) 210
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 5 cut(s) 7, 54, 126, 210, 233
MnlI CCTC 3 cut(s) 217, 230, 328
MseI TTAA 3 cut(s) 11, 86, 231
MslI CAYNNNNRTG 1 cut(s) 105
MspI CCGG 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 46
MunI CAATTG 1 cut(s) 210
NciI CCSGG 1 cut(s) 46
NdeII GATC 2 cut(s) 97, 257
NlaIV GGNNCC 1 cut(s) 217
Psp124BI GAGCTC 1 cut(s) 66
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 2 cut(s) 242, 253
RseI CAYNNNNRTG 1 cut(s) 105
SacI GAGCTC 1 cut(s) 66
SaqAI TTAA 3 cut(s) 11, 86, 231
Sau3AI GATC 2 cut(s) 97, 257
Sau96I GGNCC 2 cut(s) 242, 253
ScrFI CCNGG 1 cut(s) 46
SduI GDGCHC 1 cut(s) 66
SfcI CTRYAG 1 cut(s) 196
SinI GGWCC 1 cut(s) 242
SmiMI CAYNNNNRTG 1 cut(s) 105
Sse9I AATT 5 cut(s) 7, 54, 126, 210, 233
SspMI CTAG 1 cut(s) 95
SstI GAGCTC 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 44
TasI AATT 5 cut(s) 7, 54, 126, 210, 233
Tru1I TTAA 3 cut(s) 11, 86, 231
Tru9I TTAA 3 cut(s) 11, 86, 231
VpaK11BI GGWCC 1 cut(s) 242
XapI RAATTY 2 cut(s) 54, 126
XbaI TCTAGA 1 cut(s) 94
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.