Rh1AG255400

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
47164409 .. 47164741
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG255400.1

Sequence Viewer

Length: 333 bp
ATGTCCAATTTAAGACACCTAAAGCTCAACTCCAATGACTTCACCGGGAACAAAATTCCAGAGCTCATTTGTAATCTGACCATTTTAAGATATTTAGATCACCCTAATGCTGTCTTAGGTGGTGAAATTCCACATCATCAGCTTGGAAACCTTACCAGCAGTATCATAAACTCGCTATTACCACTTCACCCAGGGTGTAGAAAAACCTCAATTGGCTCCCTCGCTTTCTTTAAAATATCTGGACCTGACTTGGGCCGATCTAAGACTTCTGATTGGCTGGAAACAATAGACAAGCTCTCTAATCTAAGAAACTTGACCTCAATGGGGATGTGA

Protein Analysis

110

Amino Acids

12.13

Weight (kDa)

9.14

Isoelectric Point (pI)

26.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020487)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 54, 126
AfiI CCNNNNNNNGG 2 cut(s) 251, 324
AjnI CCWGG 1 cut(s) 190
AluBI AGCT 4 cut(s) 25, 64, 142, 295
AluI AGCT 4 cut(s) 25, 64, 142, 295
Alw21I GWGCWC 1 cut(s) 66
AoxI GGCC 1 cut(s) 253
ApoI RAATTY 2 cut(s) 54, 126
AspS9I GGNCC 2 cut(s) 242, 253
AsuC2I CCSGG 1 cut(s) 46
AsuHPI GGTGA 4 cut(s) 34, 92, 134, 179
AvaII GGWCC 1 cut(s) 242
BanII GRGCYC 1 cut(s) 66
Bbv12I GWGCWC 1 cut(s) 66
BciT130I CCWGG 1 cut(s) 192
BcnI CCSGG 1 cut(s) 46
Bme1390I CCNGG 2 cut(s) 46, 192
Bme18I GGWCC 1 cut(s) 242
BmgT120I GGNCC 2 cut(s) 242, 253
BmiI GGNNCC 1 cut(s) 217
BmrFI CCNGG 2 cut(s) 46, 192
BpuMI CCSGG 1 cut(s) 46
BsaJI CCNNGG 2 cut(s) 190, 191
Bsc4I CCNNNNNNNGG 2 cut(s) 251, 324
BseBI CCWGG 1 cut(s) 192
BseDI CCNNGG 2 cut(s) 190, 191
BseGI GGATG 1 cut(s) 333
BseLI CCNNNNNNNGG 2 cut(s) 251, 324
BshFI GGCC 1 cut(s) 255
BsiHKAI GWGCWC 1 cut(s) 66
BsiSI CCGG 1 cut(s) 45
BslI CCNNNNNNNGG 2 cut(s) 251, 324
BsnI GGCC 1 cut(s) 255
Bsp1286I GDGCHC 1 cut(s) 66
Bsp143I GATC 2 cut(s) 97, 257
BspANI GGCC 1 cut(s) 255
BspLI GGNNCC 1 cut(s) 217
BssECI CCNNGG 2 cut(s) 190, 191
BssMI GATC 2 cut(s) 97, 257
Bst2UI CCWGG 1 cut(s) 192
BstDEI CTNAG 3 cut(s) 115, 261, 305
BstF5I GGATG 1 cut(s) 333
BstKTI GATC 2 cut(s) 100, 260
BstMBI GATC 2 cut(s) 97, 257
BstNI CCWGG 1 cut(s) 192
BstSCI CCNGG 2 cut(s) 44, 190
BsuRI GGCC 1 cut(s) 255
BtsCI GGATG 1 cut(s) 333
Cfr13I GGNCC 2 cut(s) 242, 253
CviJI RGCY 7 cut(s) 25, 64, 142, 216, 255, 277, 295
CviKI_1 RGCY 7 cut(s) 25, 64, 142, 216, 255, 277, 295
DdeI CTNAG 3 cut(s) 115, 261, 305
DpnI GATC 2 cut(s) 99, 259
DpnII GATC 2 cut(s) 97, 257
DraI TTTAAA 1 cut(s) 232
Ecl136II GAGCTC 1 cut(s) 64
Eco24I GRGCYC 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 242
Eco53kI GAGCTC 1 cut(s) 64
EcoICRI GAGCTC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 190
EcoT38I GRGCYC 1 cut(s) 66
FaiI YATR 1 cut(s) 167
FriOI GRGCYC 1 cut(s) 66
HaeIII GGCC 1 cut(s) 255
HapII CCGG 1 cut(s) 45
HpaII CCGG 1 cut(s) 45
HphI GGTGA 4 cut(s) 34, 92, 134, 179
Hpy188I TCNGA 2 cut(s) 78, 271
Hpy188III TCNNGA 2 cut(s) 59, 240
HpyF3I CTNAG 3 cut(s) 115, 261, 305
Kzo9I GATC 2 cut(s) 97, 257
LmnI GCTCC 1 cut(s) 221
LpnPI CCDG 8 cut(s) 58, 72, 169, 177, 204, 225, 258, 263
MalI GATC 2 cut(s) 99, 259
MboI GATC 2 cut(s) 97, 257
MfeI CAATTG 1 cut(s) 210
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 4 cut(s) 7, 54, 126, 210
MnlI CCTC 3 cut(s) 217, 230, 328
MseI TTAA 3 cut(s) 11, 86, 231
MslI CAYNNNNRTG 1 cut(s) 105
MspI CCGG 1 cut(s) 45
MspR9I CCNGG 2 cut(s) 46, 192
MunI CAATTG 1 cut(s) 210
MvaI CCWGG 1 cut(s) 192
NciI CCSGG 1 cut(s) 46
NdeII GATC 2 cut(s) 97, 257
NlaIV GGNNCC 1 cut(s) 217
PasI CCCWGGG 1 cut(s) 191
Psp124BI GAGCTC 1 cut(s) 66
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 2 cut(s) 242, 253
RseI CAYNNNNRTG 1 cut(s) 105
SacI GAGCTC 1 cut(s) 66
SaqAI TTAA 3 cut(s) 11, 86, 231
Sau3AI GATC 2 cut(s) 97, 257
Sau96I GGNCC 2 cut(s) 242, 253
ScrFI CCNGG 2 cut(s) 46, 192
SduI GDGCHC 1 cut(s) 66
SinI GGWCC 1 cut(s) 242
SmiMI CAYNNNNRTG 1 cut(s) 105
Sse9I AATT 4 cut(s) 7, 54, 126, 210
SstI GAGCTC 1 cut(s) 66
StyD4I CCNGG 2 cut(s) 44, 190
TasI AATT 4 cut(s) 7, 54, 126, 210
Tru1I TTAA 3 cut(s) 11, 86, 231
Tru9I TTAA 3 cut(s) 11, 86, 231
VpaK11BI GGWCC 1 cut(s) 242
XapI RAATTY 2 cut(s) 54, 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.