RchiOBHm_Chr1g0355401

Signal peptide peptidase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
48099981 .. 48101076
1096 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGCATGCCAATCATACTAGAGTGGTTCTAGCAGACCCCCCTGATTGTTGTACCAAACCCAAGAATAAGCTTGCACATGAGGTCATTTTGGTACACCGAGGAAATTGCAGTTTTACCACCAAGGCAATTATGGCTGAATCTGCTAATGCTTCATCATAA

Protein Analysis

52

Amino Acids

5.62

Weight (kDa)

8.61

Isoelectric Point (pI)

35.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019854)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0355401
rosa_multiflora Rmu_sc0023233.1_g000001
rosa_roxburghii Rroxscaffold_4G00300300
rosa_samantha Rh4AG020100
rosa_wichuraiana Rw1G017070 Rw1G022980 Rw7G032080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 52, 93
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
BcgI CGANNNNNNTGC 2 cut(s) 87, 121
BfaI CTAG 2 cut(s) 18, 29
BsaJI CCNNGG 2 cut(s) 97, 120
BseDI CCNNGG 2 cut(s) 97, 120
BssECI CCNNGG 2 cut(s) 97, 120
BssT1I CCWWGG 1 cut(s) 120
BstC8I GCNNGC 2 cut(s) 6, 72
BstMWI GCNNNNNNNGC 2 cut(s) 131, 140
BstNSI RCATGY 1 cut(s) 8
Cac8I GCNNGC 2 cut(s) 6, 72
Csp6I GTAC 2 cut(s) 51, 92
CviAII CATG 2 cut(s) 5, 77
CviJI RGCY 2 cut(s) 70, 134
CviKI_1 RGCY 2 cut(s) 70, 134
CviQI GTAC 2 cut(s) 51, 92
Eco130I CCWWGG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 120
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 2 cut(s) 8, 80
FaiI YATR 5 cut(s) 6, 15, 78, 131, 157
FatI CATG 2 cut(s) 4, 76
FspBI CTAG 2 cut(s) 18, 29
Hin1II CATG 2 cut(s) 8, 80
HindIII AAGCTT 1 cut(s) 68
HinfI GANTC 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4V TGCA 3 cut(s) 4, 74, 108
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 140
Hsp92II CATG 2 cut(s) 8, 80
LpnPI CCDG 1 cut(s) 54
MaeI CTAG 2 cut(s) 18, 29
MluCI AATT 2 cut(s) 103, 126
MnlI CCTC 2 cut(s) 73, 92
Mph1103I ATGCAT 1 cut(s) 6
MwoI GCNNNNNNNGC 2 cut(s) 131, 140
NlaIII CATG 2 cut(s) 8, 80
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PaeI GCATGC 1 cut(s) 8
PfeI GAWTC 1 cut(s) 137
RsaI GTAC 2 cut(s) 52, 93
RsaNI GTAC 2 cut(s) 51, 92
SetI ASST 2 cut(s) 72, 84
SgeI CNNG 9 cut(s) 17, 30, 41, 53, 73, 83, 89, 110, 133
SphI GCATGC 1 cut(s) 8
Sse9I AATT 2 cut(s) 103, 126
SspMI CTAG 2 cut(s) 18, 29
StyI CCWWGG 1 cut(s) 120
TasI AATT 2 cut(s) 103, 126
TfiI GAWTC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 141
XceI RCATGY 1 cut(s) 8
XcmI CCANNNNNNNNNTGG 1 cut(s) 127
XspI CTAG 2 cut(s) 18, 29
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.