Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023233.1

Orthogroup ID

OG0019854

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 333

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023233.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 223 bp

ggcaaaccaaattcaccttatactttcaaaccctcgagattgctgcagtccaccgaaaaataagattgctcgggatgtcattatggtcgaccgaggcaactgcaaattcacaaccaaagcaaattatgcccaagctgctaatgcctcagctatccttattataaataaccagaaaggtaaacaatatatgtttccgttgtatgatacatgtgttgactattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005764 GO:0005765 GO:0005768 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005798 GO:0012505 GO:0016020 GO:0016021 GO:0030176 GO:0030660 GO:0031090 GO:0031224 GO:0031227 GO:0031410 GO:0031982 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044433 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0071458 GO:0071556 GO:0097708 GO:0098552 GO:0098553 GO:0098554 GO:0098562 GO:0098588 GO:0098805 GO:0098827 GO:0098852

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PA Peptidase_A22B

Protein Analysis

73

Amino Acids

8.19

Weight (kDa)

9.03

Isoelectric Point (pI)

28.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019854)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0355401
rosa_multiflora	Rmu_sc0023233.1_g000001
rosa_roxburghii	Rroxscaffold_4G00300300
rosa_samantha	Rh4AG020100
rosa_wichuraiana	Rw1G017070 Rw1G022980 Rw7G032080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	162
AccI	GTMKAC	1 cut(s)	88
AcsI	RAATTY	2 cut(s)	10, 105
AflIII	ACRYGT	1 cut(s)	207
AgsI	TTSAA	1 cut(s)	28
AluBI	AGCT	2 cut(s)	135, 150
AluI	AGCT	2 cut(s)	135, 150
Ama87I	CYCGRG	2 cut(s)	34, 70
ApeKI	GCWGC	2 cut(s)	43, 135
ApoI	RAATTY	2 cut(s)	10, 105
AsuHPI	GGTGA	1 cut(s)	6
AvaI	CYCGRG	2 cut(s)	34, 70
BaeI	ACNNNNGTAYC	1 cut(s)	196
BbvCI	CCTCAGC	1 cut(s)	146
BbvI	GCAGC	2 cut(s)	30, 122
BcgI	CGANNNNNNTGC	4 cut(s)	25, 59, 82, 116
BfmI	CTRYAG	1 cut(s)	44
BisI	GCNGC	2 cut(s)	44, 136
BlsI	GCNGC	2 cut(s)	45, 137
BmeT110I	CYCGRG	2 cut(s)	34, 70
Bpu10I	CCTNAGC	1 cut(s)	146
BsaJI	CCNNGG	1 cut(s)	92
BseDI	CCNNGG	1 cut(s)	92
BseGI	GGATG	1 cut(s)	80
BseMII	CTCAG	1 cut(s)	160
BseXI	GCAGC	2 cut(s)	30, 122
Bsh1285I	CGRYCG	1 cut(s)	92
BsiEI	CGRYCG	1 cut(s)	92
BsiHKCI	CYCGRG	2 cut(s)	34, 70
BsoBI	CYCGRG	2 cut(s)	34, 70
BspCNI	CTCAG	1 cut(s)	159
BspMAI	CTGCAG	1 cut(s)	48
BssECI	CCNNGG	1 cut(s)	92
BstAPI	GCANNNNNTGC	1 cut(s)	126
BstDEI	CTNAG	1 cut(s)	146
BstF5I	GGATG	1 cut(s)	80
BstMCI	CGRYCG	1 cut(s)	92
BstMWI	GCNNNNNNNGC	3 cut(s)	126, 135, 141
BstNSI	RCATGY	1 cut(s)	211
BstSFI	CTRYAG	1 cut(s)	44
BstV1I	GCAGC	2 cut(s)	30, 122
BtsCI	GGATG	1 cut(s)	80
CviAII	CATG	1 cut(s)	208
CviJI	RGCY	2 cut(s)	135, 150
CviKI_1	RGCY	2 cut(s)	135, 150
DdeI	CTNAG	1 cut(s)	146
Eco88I	CYCGRG	2 cut(s)	34, 70
FaeI	CATG	1 cut(s)	211
FaiI	YATR	8 cut(s)	21, 84, 127, 162, 187, 189, 202, 209
FatI	CATG	1 cut(s)	207
FblI	GTMKAC	1 cut(s)	88
Fnu4HI	GCNGC	2 cut(s)	44, 136
FokI	GGATG	1 cut(s)	87
Fsp4HI	GCNGC	2 cut(s)	44, 136
GluI	GCNGC	2 cut(s)	44, 136
Hin1II	CATG	1 cut(s)	211
HincII	GTYRAC	2 cut(s)	89, 215
HindII	GTYRAC	2 cut(s)	89, 215
HphI	GGTGA	1 cut(s)	6
Hpy166II	GTNNAC	4 cut(s)	51, 89, 180, 215
Hpy188III	TCNNGA	2 cut(s)	36, 72
Hpy8I	GTNNAC	4 cut(s)	51, 89, 180, 215
HpyCH4V	TGCA	2 cut(s)	46, 103
HpyF10VI	GCNNNNNNNGC	3 cut(s)	126, 135, 141
HpyF3I	CTNAG	1 cut(s)	146
Hsp92II	CATG	1 cut(s)	211
LpnPI	CCDG	1 cut(s)	183
Lsp1109I	GCAGC	2 cut(s)	30, 122
MluCI	AATT	3 cut(s)	10, 105, 122
MnlI	CCTC	3 cut(s)	43, 87, 155
MseI	TTAA	1 cut(s)	221
MwoI	GCNNNNNNNGC	3 cut(s)	126, 135, 141
NlaIII	CATG	1 cut(s)	211
NspI	RCATGY	1 cut(s)	211
PaeR7I	CTCGAG	1 cut(s)	34
PciI	ACATGT	1 cut(s)	207
PkrI	GCNGC	2 cut(s)	45, 137
PscI	ACATGT	1 cut(s)	207
PsiI	TTATAA	1 cut(s)	162
PstI	CTGCAG	1 cut(s)	48
SalI	GTCGAC	1 cut(s)	87
SaqAI	TTAA	1 cut(s)	221
SatI	GCNGC	2 cut(s)	44, 136
SetI	ASST	4 cut(s)	19, 137, 152, 179
SfcI	CTRYAG	1 cut(s)	44
Sfr274I	CTCGAG	1 cut(s)	34
SgeI	CNNG	7 cut(s)	46, 48, 82, 84, 105, 144, 182
SlaI	CTCGAG	1 cut(s)	34
SmlI	CTYRAG	1 cut(s)	34
SmoI	CTYRAG	1 cut(s)	34
Sse9I	AATT	3 cut(s)	10, 105, 122
TaqI	TCGA	2 cut(s)	35, 88
TaqII	GACCGA	1 cut(s)	106
TasI	AATT	3 cut(s)	10, 105, 122
Tru1I	TTAA	1 cut(s)	221
Tru9I	TTAA	1 cut(s)	221
TseI	GCWGC	2 cut(s)	43, 135
TspGWI	ACGGA	1 cut(s)	184
XapI	RAATTY	2 cut(s)	10, 105
XceI	RCATGY	1 cut(s)	211
XhoI	CTCGAG	1 cut(s)	34
XmiI	GTMKAC	1 cut(s)	88

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.