RchiOBHm_Chr1g0381651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66924092 .. 66924980
889 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 267 bp
ATGGCTCAGCTTAGAATCACCTTCTTCATTCTTCGAGTACTTCTCCTCTCAGTCCTTCTCATTTCCTTATCTTCAGGTAACAACATTGTTGAAGGCTTCAAGGATGGCAATGATCACCACATTGATCATTTACTTCACAAGGGCATCAAAGTGAATTCAAGGAAGCTGGTTATGATGCTAGATGCAACAATGCATGACTATGATGATGCAGGAGCGAACCCCAAACACGATCCTCGAAGGAAACCAGGCAATGGGAGAAACCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.9

Weight (kDa)

9.6

Isoelectric Point (pI)

37.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 251
AclWI GGATC 1 cut(s) 224
AcsI RAATTY 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 57
AfaI GTAC 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 251
AgsI TTSAA 3 cut(s) 92, 100, 159
AjnI CCWGG 1 cut(s) 244
AluBI AGCT 2 cut(s) 10, 166
AluI AGCT 2 cut(s) 10, 166
AlwI GGATC 1 cut(s) 224
ApoI RAATTY 1 cut(s) 154
AsuHPI GGTGA 2 cut(s) 10, 107
BccI CCATC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 246
BclI TGATCA 2 cut(s) 112, 124
BfaI CTAG 1 cut(s) 179
BlpI GCTNAGC 1 cut(s) 6
BmcAI AGTACT 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 246
BmsI GCATC 4 cut(s) 153, 165, 172, 196
BplI GAGNNNNNCTC 2 cut(s) 27, 59
Bpu1102I GCTNAGC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 251
Bse3DI GCAATG 2 cut(s) 115, 256
BseBI CCWGG 1 cut(s) 246
BseGI GGATG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 251
BseMI GCAATG 2 cut(s) 115, 256
BseMII CTCAG 2 cut(s) 20, 63
BseRI GAGGAG 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 251
Bsp143I GATC 3 cut(s) 112, 124, 229
Bsp1720I GCTNAGC 1 cut(s) 6
BspCNI CTCAG 2 cut(s) 19, 62
BspPI GGATC 1 cut(s) 224
BsrDI GCAATG 2 cut(s) 115, 256
BssMI GATC 3 cut(s) 112, 124, 229
Bst2UI CCWGG 1 cut(s) 246
BstDEI CTNAG 3 cut(s) 6, 11, 49
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 3 cut(s) 115, 127, 232
BstMBI GATC 3 cut(s) 112, 124, 229
BstNI CCWGG 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 244
BtsCI GGATG 1 cut(s) 109
Csp6I GTAC 1 cut(s) 38
CviAII CATG 2 cut(s) 194, 264
CviJI RGCY 4 cut(s) 5, 10, 96, 166
CviKI_1 RGCY 4 cut(s) 5, 10, 96, 166
CviQI GTAC 1 cut(s) 38
DdeI CTNAG 3 cut(s) 6, 11, 49
DpnI GATC 3 cut(s) 114, 126, 231
DpnII GATC 3 cut(s) 112, 124, 229
Eco57I CTGAAG 1 cut(s) 57
EcoRI GAATTC 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 244
EcoT22I ATGCAT 1 cut(s) 195
FaeI CATG 2 cut(s) 197, 267
FaiI YATR 4 cut(s) 173, 195, 201, 265
FatI CATG 2 cut(s) 193, 263
FbaI TGATCA 2 cut(s) 112, 124
FokI GGATG 1 cut(s) 116
FspBI CTAG 1 cut(s) 179
Hin1II CATG 2 cut(s) 197, 267
HinfI GANTC 1 cut(s) 15
HphI GGTGA 2 cut(s) 10, 107
HpyAV CCTTC 4 cut(s) 31, 65, 86, 231
HpyCH4V TGCA 3 cut(s) 185, 193, 209
HpyF3I CTNAG 3 cut(s) 6, 11, 49
Hsp92II CATG 2 cut(s) 197, 267
Ksp22I TGATCA 2 cut(s) 112, 124
Kzo9I GATC 3 cut(s) 112, 124, 229
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 5 cut(s) 60, 152, 195, 231, 258
LweI GCATC 4 cut(s) 153, 165, 172, 196
MaeI CTAG 1 cut(s) 179
MaeIII GTNAC 1 cut(s) 77
MalI GATC 3 cut(s) 114, 126, 231
MboI GATC 3 cut(s) 112, 124, 229
MboII GAAGA 3 cut(s) 16, 23, 63
MluCI AATT 1 cut(s) 154
MnlI CCTC 2 cut(s) 56, 243
Mph1103I ATGCAT 1 cut(s) 195
MslI CAYNNNNRTG 2 cut(s) 149, 198
MspR9I CCNGG 1 cut(s) 246
MvaI CCWGG 1 cut(s) 246
NdeII GATC 3 cut(s) 112, 124, 229
NlaIII CATG 2 cut(s) 197, 267
NsiI ATGCAT 1 cut(s) 195
PfeI GAWTC 1 cut(s) 15
PflMI CCANNNNNTGG 1 cut(s) 251
Psp6I CCWGG 1 cut(s) 244
PspGI CCWGG 1 cut(s) 244
RsaI GTAC 1 cut(s) 39
RsaNI GTAC 1 cut(s) 38
RseI CAYNNNNRTG 2 cut(s) 149, 198
Sau3AI GATC 3 cut(s) 112, 124, 229
ScaI AGTACT 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 246
SetI ASST 4 cut(s) 12, 23, 79, 168
SfaNI GCATC 4 cut(s) 153, 165, 172, 196
SmiMI CAYNNNNRTG 2 cut(s) 149, 198
Sse9I AATT 1 cut(s) 154
SspMI CTAG 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 244
TaqI TCGA 2 cut(s) 34, 235
TasI AATT 1 cut(s) 154
TatI WGTACW 1 cut(s) 37
TfiI GAWTC 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 16
Van91I CCANNNNNTGG 1 cut(s) 251
XapI RAATTY 1 cut(s) 154
XspI CTAG 1 cut(s) 179
ZrmI AGTACT 1 cut(s) 39
Zsp2I ATGCAT 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.