RchiOBHm_Chr1g0318511

Leucine Rich Repeat

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
6064970 .. 6067369
2400 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54880

Sequence Viewer

Length: 126 bp
ATGGAGCTGGAAAATATTACCACTCTCACATACCTGAGTCTTGAAGCAAATCAAATCTCTGGAGTTGTTCCTCCTCAGCTTGGGAGTTTAATCGACTTGGAAGGATATTGTCCTCCAATTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

41

Amino Acids

4.45

Weight (kDa)

4.05

Isoelectric Point (pI)

40.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 80
AgsI TTSAA 1 cut(s) 44
AluBI AGCT 2 cut(s) 7, 79
AluI AGCT 2 cut(s) 7, 79
BbvCI CCTCAGC 1 cut(s) 75
BpmI CTGGAG 1 cut(s) 81
Bpu10I CCTNAGC 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseLI CCNNNNNNNGG 1 cut(s) 80
BseMII CTCAG 2 cut(s) 26, 89
BseRI GAGGAG 1 cut(s) 63
BslI CCNNNNNNNGG 1 cut(s) 80
BspCNI CTCAG 2 cut(s) 27, 88
BstDEI CTNAG 2 cut(s) 35, 75
CviJI RGCY 2 cut(s) 7, 79
CviKI_1 RGCY 2 cut(s) 7, 79
DdeI CTNAG 2 cut(s) 35, 75
FaiI YATR 1 cut(s) 31
FspEI CC 9 cut(s) 34, 45, 47, 66, 67, 83, 84, 87, 87
GsuI CTGGAG 1 cut(s) 81
HinfI GANTC 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 41, 60
HpyAV CCTTC 1 cut(s) 95
HpyF3I CTNAG 2 cut(s) 35, 75
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 45, 47
MluCI AATT 1 cut(s) 117
MlyI GAGTC 1 cut(s) 46
MnlI CCTC 3 cut(s) 81, 84, 123
MseI TTAA 1 cut(s) 89
PleI GAGTC 1 cut(s) 45
PpsI GAGTC 1 cut(s) 45
SaqAI TTAA 1 cut(s) 89
SchI GAGTC 1 cut(s) 46
SetI ASST 3 cut(s) 9, 36, 81
SgeI CNNG 6 cut(s) 20, 46, 53, 72, 92, 109
Sse9I AATT 1 cut(s) 117
SspI AATATT 1 cut(s) 16
TaqI TCGA 1 cut(s) 93
TasI AATT 1 cut(s) 117
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.