Rh2DG509500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
73378935 .. 73383478
4544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG509500.1

Sequence Viewer

Length: 228 bp
ATGGGAAACTTGACCAAGCTCACCTGGTTAGATATCCAGCAAAATCAATTGAGTGGCCTCATCCCACCAGAATTAGGCAAGCTCACATTGCTATTCAAGTTAGGGCTGTTTTTAAACAATCTCAATGGCTCTATTCCTGGAGAGCTAAACAACCTTACAAACTTGCAAAATTTAGGGAAAGTCAATGTAATCTATACCATTAATAAAGCATTCTTGCTTAATATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.32

Weight (kDa)

9.3

Isoelectric Point (pI)

6.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 169
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 97
AjnI CCWGG 2 cut(s) 23, 136
AluBI AGCT 3 cut(s) 19, 82, 145
AluI AGCT 3 cut(s) 19, 82, 145
AoxI GGCC 1 cut(s) 55
ApoI RAATTY 1 cut(s) 169
AseI ATTAAT 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 13
BciT130I CCWGG 2 cut(s) 25, 138
Bme1390I CCNGG 2 cut(s) 25, 138
BmrFI CCNGG 2 cut(s) 25, 138
BpmI CTGGAG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 86
BseBI CCWGG 2 cut(s) 25, 138
BseGI GGATG 1 cut(s) 60
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMI GCAATG 1 cut(s) 86
BshFI GGCC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 209
BsnI GGCC 1 cut(s) 57
BspANI GGCC 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 86
Bst2UI CCWGG 2 cut(s) 25, 138
BstC8I GCNNGC 1 cut(s) 80
BstF5I GGATG 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstNI CCWGG 2 cut(s) 25, 138
BstSCI CCNGG 2 cut(s) 23, 136
BsuRI GGCC 1 cut(s) 57
BtsCI GGATG 1 cut(s) 60
Cac8I GCNNGC 1 cut(s) 80
CsiI ACCWGGT 1 cut(s) 23
CviJI RGCY 6 cut(s) 19, 57, 82, 106, 129, 145
CviKI_1 RGCY 6 cut(s) 19, 57, 82, 106, 129, 145
DraI TTTAAA 1 cut(s) 114
Eco32I GATATC 1 cut(s) 34
EcoRII CCWGG 2 cut(s) 23, 136
EcoRV GATATC 1 cut(s) 34
FaiI YATR 2 cut(s) 195, 224
FokI GGATG 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 57
HphI GGTGA 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
LpnPI CCDG 6 cut(s) 10, 37, 50, 81, 123, 150
MabI ACCWGGT 1 cut(s) 23
MfeI CAATTG 1 cut(s) 47
MluCI AATT 3 cut(s) 47, 71, 169
MnlI CCTC 1 cut(s) 68
MseI TTAA 3 cut(s) 113, 201, 219
MspR9I CCNGG 2 cut(s) 25, 138
MunI CAATTG 1 cut(s) 47
Mva1269I GAATGC 1 cut(s) 209
MvaI CCWGG 2 cut(s) 25, 138
MwoI GCNNNNNNNGC 1 cut(s) 88
PctI GAATGC 1 cut(s) 209
PfoI TCCNGGA 1 cut(s) 136
PshBI ATTAAT 1 cut(s) 201
Psp6I CCWGG 2 cut(s) 23, 136
PspGI CCWGG 2 cut(s) 23, 136
SaqAI TTAA 3 cut(s) 113, 201, 219
ScrFI CCNGG 2 cut(s) 25, 138
SetI ASST 5 cut(s) 21, 26, 84, 147, 156
SexAI ACCWGGT 1 cut(s) 23
Sse9I AATT 3 cut(s) 47, 71, 169
StyD4I CCNGG 2 cut(s) 23, 136
TasI AATT 3 cut(s) 47, 71, 169
Tru1I TTAA 3 cut(s) 113, 201, 219
Tru9I TTAA 3 cut(s) 113, 201, 219
VspI ATTAAT 1 cut(s) 201
XapI RAATTY 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.