RchiOBHm_Chr1g0321291

chaperone protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
8885882 .. 8890863
4982 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55136

Sequence Viewer

Length: 156 bp
ATGTTTAGATTTGATAATGGAAGAATTAGAGAGAGATATATAACTAATGCATACACCCTTATCAGTGAAGTTGATCCCATAGTAGCATCCTTCTCTGGAGGAGCAATTGGAGTGATCTTAGCACTGACGGTGGTTGAGAAGTATGGAGTGAGTTGA

Protein Analysis

51

Amino Acids

5.61

Weight (kDa)

6.04

Isoelectric Point (pI)

5.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 68
AlwI GGATC 1 cut(s) 68
BmsI GCATC 1 cut(s) 95
BpmI CTGGAG 1 cut(s) 117
BseGI GGATG 1 cut(s) 86
BseRI GAGGAG 1 cut(s) 114
Bsp143I GATC 2 cut(s) 73, 114
BspPI GGATC 1 cut(s) 68
BssMI GATC 2 cut(s) 73, 114
Bst4CI ACNGT 1 cut(s) 130
BstDEI CTNAG 1 cut(s) 118
BstF5I GGATG 1 cut(s) 86
BstKTI GATC 2 cut(s) 76, 117
BstMBI GATC 2 cut(s) 73, 114
BtsCI GGATG 1 cut(s) 86
BtsIMutI CAGTG 2 cut(s) 70, 122
DdeI CTNAG 1 cut(s) 118
DpnI GATC 2 cut(s) 75, 116
DpnII GATC 2 cut(s) 73, 114
EcoT22I ATGCAT 1 cut(s) 52
FaiI YATR 5 cut(s) 39, 41, 52, 80, 144
FokI GGATG 1 cut(s) 73
GsuI CTGGAG 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 100
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 118
Kzo9I GATC 2 cut(s) 73, 114
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 1 cut(s) 81
LweI GCATC 1 cut(s) 95
MalI GATC 2 cut(s) 75, 116
MboI GATC 2 cut(s) 73, 114
MboII GAAGA 1 cut(s) 33
MfeI CAATTG 1 cut(s) 105
MluCI AATT 2 cut(s) 24, 105
MnlI CCTC 1 cut(s) 92
Mph1103I ATGCAT 1 cut(s) 52
MunI CAATTG 1 cut(s) 105
NdeII GATC 2 cut(s) 73, 114
NsiI ATGCAT 1 cut(s) 52
Sau3AI GATC 2 cut(s) 73, 114
SfaNI GCATC 1 cut(s) 95
SgeI CNNG 1 cut(s) 108
Sse9I AATT 2 cut(s) 24, 105
TaaI ACNGT 1 cut(s) 130
TasI AATT 2 cut(s) 24, 105
TscAI CASTG 2 cut(s) 70, 129
TspRI CASTG 2 cut(s) 70, 129
Zsp2I ATGCAT 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.