RchiOBHm_Chr1g0384091

Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
68124083 .. 68126984
2902 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60694

Sequence Viewer

Length: 471 bp
ATGACGACGGTGGTGAAGAGCGTGTTGCAGGCGATCAGAGAGAAAGGTCTCCGCAGTCTCTTGAGGGAGGCGAGGGAAGAAGGTTACCTGAAATGTCTAGCTGATGGAAACCTTCTGCAAACTAAAATCCACAATATCGGGGCAAGGCTTGTTGGTGTTGATAAAGTTGGGAACAAATATTATGAGAATCTTGACACTCAATATGGAAGACACAGGTGGGTTGAATATGTGGAGAAAGGTCGCTACAACGCTTCTCAAGTGCCACCAGAATGGCATGGTTGGCTACACTACATAACAGATCATACAGGAGACGAGCTTCTGATGCTAAAGCCACAGAGGTATCACCTTGAACACAAGGAAAATTTCACTGGTGAGGGTGATGAGTTTATCTACCACTCCAAAGGGCACAGCCTCAATCCAGGGCAGAGAGACTGGACCAGGTACCAGCCTTGGGAACCAACAAAACCCTGA

Protein Analysis

156

Amino Acids

18.36

Weight (kDa)

7.89

Isoelectric Point (pI)

30.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NDUFA12 PF05071 49 - 153 1.3e-26 NADH ubiquinone oxidoreductase subunit NDUFA12
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013227)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 441
AccB1I GGYRCC 1 cut(s) 441
AciI CCGC 1 cut(s) 52
AcsI RAATTY 1 cut(s) 361
AfaI GTAC 1 cut(s) 443
AfiI CCNNNNNNNGG 1 cut(s) 451
AgsI TTSAA 2 cut(s) 224, 350
AjnI CCWGG 2 cut(s) 418, 437
AluBI AGCT 2 cut(s) 101, 316
AluI AGCT 2 cut(s) 101, 316
Alw26I GTCTC 4 cut(s) 53, 62, 303, 423
ApoI RAATTY 1 cut(s) 361
Asp718I GGTACC 1 cut(s) 441
AspS9I GGNCC 1 cut(s) 435
AsuHPI GGTGA 4 cut(s) 25, 335, 383, 389
AvaII GGWCC 1 cut(s) 435
BaeGI GKGCMC 1 cut(s) 408
BaeI ACNNNNGTAYC 2 cut(s) 323, 356
BanI GGYRCC 1 cut(s) 441
BbsI GAAGAC 1 cut(s) 214
BccI CCATC 1 cut(s) 98
BciT130I CCWGG 2 cut(s) 420, 439
BcoDI GTCTC 4 cut(s) 53, 62, 303, 423
BfaI CTAG 1 cut(s) 98
Bme1390I CCNGG 2 cut(s) 420, 439
Bme18I GGWCC 1 cut(s) 435
BmgT120I GGNCC 1 cut(s) 435
BmiI GGNNCC 2 cut(s) 443, 456
BmrFI CCNGG 2 cut(s) 420, 439
BmsI GCATC 1 cut(s) 312
BpiI GAAGAC 1 cut(s) 214
BpuEI CTTGAG 2 cut(s) 82, 240
BsaI GGTCTC 1 cut(s) 53
BsaJI CCNNGG 2 cut(s) 419, 449
Bsc4I CCNNNNNNNGG 1 cut(s) 451
Bse1I ACTGG 2 cut(s) 373, 437
BseBI CCWGG 2 cut(s) 420, 439
BseDI CCNNGG 2 cut(s) 419, 449
BseLI CCNNNNNNNGG 1 cut(s) 451
BseNI ACTGG 2 cut(s) 373, 437
BseSI GKGCMC 1 cut(s) 408
BshNI GGYRCC 1 cut(s) 441
BslI CCNNNNNNNGG 1 cut(s) 451
BsmAI GTCTC 4 cut(s) 53, 62, 303, 423
BsmBI CGTCTC 1 cut(s) 303
Bso31I GGTCTC 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 408
Bsp143I GATC 2 cut(s) 33, 298
BspACI CCGC 1 cut(s) 52
BspLI GGNNCC 2 cut(s) 443, 456
BspQI GCTCTTC 1 cut(s) 11
BspT107I GGYRCC 1 cut(s) 441
BspTNI GGTCTC 1 cut(s) 53
BsrI ACTGG 2 cut(s) 373, 437
BssECI CCNNGG 2 cut(s) 419, 449
BssMI GATC 2 cut(s) 33, 298
BssT1I CCWWGG 1 cut(s) 449
Bst2UI CCWGG 2 cut(s) 420, 439
Bst4CI ACNGT 1 cut(s) 10
Bst6I CTCTTC 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 30
BstEII GGTNACC 1 cut(s) 83
BstKTI GATC 2 cut(s) 36, 301
BstMAI GTCTC 4 cut(s) 53, 62, 303, 423
BstMBI GATC 2 cut(s) 33, 298
BstMWI GCNNNNNNNGC 2 cut(s) 280, 322
BstNI CCWGG 2 cut(s) 420, 439
BstPI GGTNACC 1 cut(s) 83
BstSCI CCNGG 2 cut(s) 418, 437
BstSLI GKGCMC 1 cut(s) 408
BstV2I GAAGAC 1 cut(s) 214
BstXI CCANNNNNNTGG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 366
Cac8I GCNNGC 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 435
CsiI ACCWGGT 1 cut(s) 437
Csp6I GTAC 1 cut(s) 442
CviAII CATG 1 cut(s) 275
CviJI RGCY 7 cut(s) 101, 148, 283, 316, 331, 411, 448
CviKI_1 RGCY 7 cut(s) 101, 148, 283, 316, 331, 411, 448
CviQI GTAC 1 cut(s) 442
DpnI GATC 2 cut(s) 35, 300
DpnII GATC 2 cut(s) 33, 298
Eam1104I CTCTTC 1 cut(s) 11
EarI CTCTTC 1 cut(s) 11
Eco130I CCWWGG 1 cut(s) 449
Eco31I GGTCTC 1 cut(s) 53
Eco47I GGWCC 1 cut(s) 435
Eco91I GGTNACC 1 cut(s) 83
EcoO65I GGTNACC 1 cut(s) 83
EcoRII CCWGG 2 cut(s) 418, 437
EcoT14I CCWWGG 1 cut(s) 449
ErhI CCWWGG 1 cut(s) 449
Esp3I CGTCTC 1 cut(s) 303
FaeI CATG 1 cut(s) 278
FaiI YATR 6 cut(s) 183, 204, 228, 276, 293, 303
FatI CATG 1 cut(s) 274
FspBI CTAG 1 cut(s) 98
Hin1II CATG 1 cut(s) 278
HinfI GANTC 1 cut(s) 187
HphI GGTGA 4 cut(s) 25, 335, 383, 389
Hpy188I TCNGA 2 cut(s) 38, 321
Hpy188III TCNNGA 2 cut(s) 61, 191
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 2 cut(s) 74, 122
HpyCH4III ACNGT 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 28, 118
HpyF10VI GCNNNNNNNGC 2 cut(s) 280, 322
Hsp92II CATG 1 cut(s) 278
KpnI GGTACC 1 cut(s) 445
Kzo9I GATC 2 cut(s) 33, 298
LguI GCTCTTC 1 cut(s) 11
LweI GCATC 1 cut(s) 312
MabI ACCWGGT 1 cut(s) 437
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 83
MalI GATC 2 cut(s) 35, 300
MboI GATC 2 cut(s) 33, 298
MboII GAAGA 3 cut(s) 28, 89, 219
MhlI GDGCHC 1 cut(s) 408
MluCI AATT 1 cut(s) 361
MnlI CCTC 6 cut(s) 57, 61, 66, 330, 367, 422
MslI CAYNNNNRTG 1 cut(s) 268
MspR9I CCNGG 2 cut(s) 420, 439
MvaI CCWGG 2 cut(s) 420, 439
MwoI GCNNNNNNNGC 2 cut(s) 280, 322
NdeII GATC 2 cut(s) 33, 298
NlaIII CATG 1 cut(s) 278
NlaIV GGNNCC 2 cut(s) 443, 456
PciSI GCTCTTC 1 cut(s) 11
PfeI GAWTC 1 cut(s) 187
Psp6I CCWGG 2 cut(s) 418, 437
PspEI GGTNACC 1 cut(s) 83
PspGI CCWGG 2 cut(s) 418, 437
PspN4I GGNNCC 2 cut(s) 443, 456
PspPI GGNCC 1 cut(s) 435
RsaI GTAC 1 cut(s) 443
RsaNI GTAC 1 cut(s) 442
RseI CAYNNNNRTG 1 cut(s) 268
SapI GCTCTTC 1 cut(s) 11
Sau3AI GATC 2 cut(s) 33, 298
Sau96I GGNCC 1 cut(s) 435
ScrFI CCNGG 2 cut(s) 420, 439
SduI GDGCHC 1 cut(s) 408
SexAI ACCWGGT 1 cut(s) 437
SfaNI GCATC 1 cut(s) 312
SinI GGWCC 1 cut(s) 435
SmiMI CAYNNNNRTG 1 cut(s) 268
SmlI CTYRAG 2 cut(s) 61, 255
SmoI CTYRAG 2 cut(s) 61, 255
Sse9I AATT 1 cut(s) 361
SsiI CCGC 1 cut(s) 52
SspI AATATT 1 cut(s) 179
SspMI CTAG 1 cut(s) 98
StyD4I CCNGG 2 cut(s) 418, 437
StyI CCWWGG 1 cut(s) 449
TaaI ACNGT 1 cut(s) 10
TasI AATT 1 cut(s) 361
TfiI GAWTC 1 cut(s) 187
TscAI CASTG 1 cut(s) 373
TspRI CASTG 1 cut(s) 373
VpaK11BI GGWCC 1 cut(s) 435
XapI RAATTY 1 cut(s) 361
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.