RchiOBHm_Chr2g0091981

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
5591058 .. 5591992
935 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46715

Sequence Viewer

Length: 168 bp
ATGAGTAGTGGAGTCGGATCGAGCAGTAGTATTCGGCAGGCTAGAGATTTTGCAGTAGCACAGGCACAACAGGATGGTGTCCTTGGAAACTTCAAGATCTTTGATTCACCCTTTGGCAATTTTCTTGTTCCTGTAATTCCAACTGCCAAGGAACTAGCTGATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

5.74

Weight (kDa)

4.78

Isoelectric Point (pI)

48.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017212)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g06280
malus_domestica MD02G1066600.v1.1 MD15G1197100.v1.1
prunus_persica Prupe.7G218700_v2.0.a1
pyrus_communis pycom02g05270
rosa_chinensis RchiOBHm_Chr2g0091981
rosa_roxburghii Rroxscaffold_2G00149560
rosa_rugosa Rorug02G0022100
rosa_samantha Rh2AG067700 Rh2BG067000 Rh2CG068300 Rh2DG066800
rosa_wichuraiana Rw2G005330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 25
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
AlwI GGATC 1 cut(s) 25
AsuHPI GGTGA 1 cut(s) 99
BccI CCATC 1 cut(s) 68
BfaI CTAG 2 cut(s) 42, 155
BglII AGATCT 1 cut(s) 96
BmsI GCATC 1 cut(s) 151
BsaJI CCNNGG 2 cut(s) 82, 147
BseDI CCNNGG 2 cut(s) 82, 147
BseGI GGATG 1 cut(s) 79
Bsp143I GATC 2 cut(s) 17, 96
BspPI GGATC 1 cut(s) 25
BssECI CCNNGG 2 cut(s) 82, 147
BssMI GATC 2 cut(s) 17, 96
BssT1I CCWWGG 2 cut(s) 82, 147
BstC8I GCNNGC 1 cut(s) 39
BstDEI CTNAG 1 cut(s) 165
BstF5I GGATG 1 cut(s) 79
BstKTI GATC 2 cut(s) 20, 99
BstMBI GATC 2 cut(s) 17, 96
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BtsCI GGATG 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 39
CviJI RGCY 2 cut(s) 41, 158
CviKI_1 RGCY 2 cut(s) 41, 158
DdeI CTNAG 1 cut(s) 165
DpnI GATC 2 cut(s) 19, 98
DpnII GATC 2 cut(s) 17, 96
Eco130I CCWWGG 2 cut(s) 82, 147
EcoT14I CCWWGG 2 cut(s) 82, 147
ErhI CCWWGG 2 cut(s) 82, 147
FokI GGATG 1 cut(s) 86
FspBI CTAG 2 cut(s) 42, 155
HinfI GANTC 2 cut(s) 12, 104
HphI GGTGA 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 165
Kzo9I GATC 2 cut(s) 17, 96
LpnPI CCDG 4 cut(s) 23, 47, 56, 144
LweI GCATC 1 cut(s) 151
MaeI CTAG 2 cut(s) 42, 155
MalI GATC 2 cut(s) 19, 98
MboI GATC 2 cut(s) 17, 96
MflI RGATCY 1 cut(s) 96
MluCI AATT 2 cut(s) 118, 135
MlyI GAGTC 1 cut(s) 21
MmeI TCCRAC 1 cut(s) 164
NdeII GATC 2 cut(s) 17, 96
PfeI GAWTC 1 cut(s) 104
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
PsuI RGATCY 1 cut(s) 96
Sau3AI GATC 2 cut(s) 17, 96
SchI GAGTC 1 cut(s) 21
SetI ASST 1 cut(s) 160
SfaNI GCATC 1 cut(s) 151
Sse9I AATT 2 cut(s) 118, 135
SspMI CTAG 2 cut(s) 42, 155
StyI CCWWGG 2 cut(s) 82, 147
TaqI TCGA 1 cut(s) 20
TasI AATT 2 cut(s) 118, 135
TfiI GAWTC 1 cut(s) 104
XspI CTAG 2 cut(s) 42, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.