RchiOBHm_Chr2g0108641

Translocon-associated protein subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
20021280 .. 20023368
2089 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48252

Sequence Viewer

Length: 237 bp
ATGAGAGCTGACCTCAAGATCTCTTTGATTTCGTCAACGGCAAATGCTTTCAAGTCATGGGAAAGGATTGATGTAGGTGGCATTATATCCCACTCTTTTGAATTGGAGGCCAAAACGAAAGGAATGTTTAGTGGTGCAACAACTGTTATTACATTTCGCTTTCCCTCAAAGGCTGCTCTGCAGGAGAGTGTTGATGCTTTTATCAGCTATGTTGTGAAAAACAAAGGATTTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.54

Weight (kDa)

9.52

Isoelectric Point (pI)

18.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TRAP_beta PF05753 16 - 64 1e-09 Translocon-associated protein beta (TRAPB)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 52, 101
AluBI AGCT 3 cut(s) 8, 207, 234
AluI AGCT 3 cut(s) 8, 207, 234
AoxI GGCC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 173
BbvI GCAGC 1 cut(s) 160
BceAI ACGGC 1 cut(s) 54
BfaI CTAG 1 cut(s) 235
BfmI CTRYAG 1 cut(s) 179
BglII AGATCT 1 cut(s) 18
BisI GCNGC 1 cut(s) 174
BlsI GCNGC 1 cut(s) 175
BmsI GCATC 1 cut(s) 184
BplI GAGNNNNNCTC 1 cut(s) 29
BseXI GCAGC 1 cut(s) 160
BshFI GGCC 1 cut(s) 110
BsnI GGCC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 18
BspANI GGCC 1 cut(s) 110
BspMAI CTGCAG 1 cut(s) 183
BssMI GATC 1 cut(s) 18
Bst4CI ACNGT 1 cut(s) 145
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 179
BstV1I GCAGC 1 cut(s) 160
BstX2I RGATCY 1 cut(s) 18
BstYI RGATCY 1 cut(s) 18
BsuRI GGCC 1 cut(s) 110
CviAII CATG 1 cut(s) 57
CviJI RGCY 5 cut(s) 8, 110, 173, 207, 234
CviKI_1 RGCY 5 cut(s) 8, 110, 173, 207, 234
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
FaeI CATG 1 cut(s) 60
FaiI YATR 3 cut(s) 58, 86, 210
FatI CATG 1 cut(s) 56
Fnu4HI GCNGC 1 cut(s) 174
Fsp4HI GCNGC 1 cut(s) 174
FspBI CTAG 1 cut(s) 235
GluI GCNGC 1 cut(s) 174
HaeIII GGCC 1 cut(s) 110
Hin1II CATG 1 cut(s) 60
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
Hpy166II GTNNAC 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 36
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4V TGCA 2 cut(s) 137, 181
Hsp92II CATG 1 cut(s) 60
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 1 cut(s) 167
Lsp1109I GCAGC 1 cut(s) 160
LweI GCATC 1 cut(s) 184
MaeI CTAG 1 cut(s) 235
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MflI RGATCY 1 cut(s) 18
MluCI AATT 1 cut(s) 101
MnlI CCTC 3 cut(s) 23, 100, 175
NdeII GATC 1 cut(s) 18
NlaIII CATG 1 cut(s) 60
PkrI GCNGC 1 cut(s) 175
PstI CTGCAG 1 cut(s) 183
PsuI RGATCY 1 cut(s) 18
SatI GCNGC 1 cut(s) 174
Sau3AI GATC 1 cut(s) 18
SetI ASST 5 cut(s) 10, 15, 79, 209, 236
SfaNI GCATC 1 cut(s) 184
SfcI CTRYAG 1 cut(s) 179
SgeI CNNG 4 cut(s) 28, 64, 69, 194
SmlI CTYRAG 1 cut(s) 14
SmoI CTYRAG 1 cut(s) 14
Sse9I AATT 1 cut(s) 101
SspMI CTAG 1 cut(s) 235
TaaI ACNGT 1 cut(s) 145
TasI AATT 1 cut(s) 101
TseI GCWGC 1 cut(s) 173
XspI CTAG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.