RchiOBHm_Chr2g0118381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
30672662 .. 30673232
571 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49120

Sequence Viewer

Length: 171 bp
ATGATGATCCAAAATGTTCGCAGGGTTCAGATGATGAGAAAGGTGATGAGAGTGGTCATGCAACCGGGAGTCAGAATGAGAACCCCAGTGTCAATCCCAAATCTTCAGGAAACTCGAAAAATGGTAATCTTTATTGTTAGTGCTTTGAATTTTGAGTCTGAAATGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.65

Weight (kDa)

11.88

Isoelectric Point (pI)

36.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 89
AgsI TTSAA 1 cut(s) 148
ApoI RAATTY 1 cut(s) 148
AsuC2I CCSGG 1 cut(s) 66
AsuHPI GGTGA 1 cut(s) 55
BcnI CCSGG 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 66
BmrI ACTGGG 1 cut(s) 80
BmuI ACTGGG 1 cut(s) 80
BpuMI CCSGG 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 86
BsiSI CCGG 1 cut(s) 65
Bsp143I GATC 2 cut(s) 6, 165
BsrI ACTGG 1 cut(s) 86
BssMI GATC 2 cut(s) 6, 165
BstKTI GATC 2 cut(s) 9, 168
BstMBI GATC 2 cut(s) 6, 165
BstSCI CCNGG 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 93
CviAII CATG 1 cut(s) 58
DpnI GATC 2 cut(s) 8, 167
DpnII GATC 2 cut(s) 6, 165
Eco57I CTGAAG 1 cut(s) 89
FaeI CATG 1 cut(s) 61
FaiI YATR 1 cut(s) 59
FatI CATG 1 cut(s) 57
HapII CCGG 1 cut(s) 65
Hin1II CATG 1 cut(s) 61
HinfI GANTC 2 cut(s) 69, 155
HpaII CCGG 1 cut(s) 65
HphI GGTGA 1 cut(s) 55
Hpy188I TCNGA 4 cut(s) 30, 74, 160, 170
Hpy188III TCNNGA 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 61
Hsp92II CATG 1 cut(s) 61
Kzo9I GATC 2 cut(s) 6, 165
LpnPI CCDG 4 cut(s) 7, 78, 92, 99
MalI GATC 2 cut(s) 8, 167
MboI GATC 2 cut(s) 6, 165
MboII GAAGA 1 cut(s) 95
MluCI AATT 1 cut(s) 148
MlyI GAGTC 2 cut(s) 78, 164
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 66
NciI CCSGG 1 cut(s) 66
NdeII GATC 2 cut(s) 6, 165
NlaIII CATG 1 cut(s) 61
PleI GAGTC 2 cut(s) 77, 163
PpsI GAGTC 2 cut(s) 77, 163
Sau3AI GATC 2 cut(s) 6, 165
SchI GAGTC 2 cut(s) 78, 164
ScrFI CCNGG 1 cut(s) 66
SetI ASST 1 cut(s) 45
SgeI CNNG 7 cut(s) 34, 70, 77, 78, 98, 119, 126
Sse9I AATT 1 cut(s) 148
StyD4I CCNGG 1 cut(s) 64
TaqI TCGA 1 cut(s) 115
TasI AATT 1 cut(s) 148
TscAI CASTG 1 cut(s) 93
TspRI CASTG 1 cut(s) 93
XapI RAATTY 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.