RchiOBHm_Chr2g0132071

Belongs to the eukaryotic ribosomal protein eS6 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
48448751 .. 48450096
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50335

Sequence Viewer

Length: 276 bp
ATGAAGGCTTTTCTCTGTTCGATTTCTCCTCTCTCTCTCTCTCTCCTCTTCCTGGGTATCGCTGATCTAACCTCCTTCGTTTGTGTTTTGCACTTCAACATCGCCAACCTCACCACAGGTTGCCAGAAGAAGTTGGAGATCGATGACGACCATAAACTGAGTGCCTCTTCTGACAAGAGGATCTCACAGGAATTGAGTGGAGATGCCTTTGGAGAGGAATTTAAGGGATATGTCTTTAAGATTATGGGAGGCTGTGTGACAAGCGAGGGTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

9.83

Weight (kDa)

5.16

Isoelectric Point (pI)

24.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S6e PF01092 31 - 85 1.1e-13 Ribosomal protein S6e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019326)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 188
AcsI RAATTY 1 cut(s) 218
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 97
AjnI CCWGG 1 cut(s) 51
AlwI GGATC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 103
BciT130I CCWGG 1 cut(s) 53
Bme1390I CCNGG 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 53
BmsI GCATC 1 cut(s) 193
Bsa29I ATCGAT 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 240, 270
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseBI CCWGG 1 cut(s) 53
BseCI ATCGAT 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 149
BseRI GAGGAG 2 cut(s) 18, 35
BshVI ATCGAT 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 52
Bsp143I GATC 3 cut(s) 64, 138, 180
BspCNI CTCAG 1 cut(s) 150
BspDI ATCGAT 1 cut(s) 141
BspHI TCATGA 1 cut(s) 272
BspPI GGATC 1 cut(s) 188
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 3 cut(s) 64, 138, 180
Bst2UI CCWGG 1 cut(s) 53
Bst6I CTCTTC 2 cut(s) 53, 172
BstDEI CTNAG 1 cut(s) 158
BstKTI GATC 3 cut(s) 67, 141, 183
BstMBI GATC 3 cut(s) 64, 138, 180
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 180
BstYI RGATCY 1 cut(s) 180
Bsu15I ATCGAT 1 cut(s) 141
BsuTUI ATCGAT 1 cut(s) 141
BtgZI GCGATG 1 cut(s) 85
CciI TCATGA 1 cut(s) 272
ClaI ATCGAT 1 cut(s) 141
CviAII CATG 1 cut(s) 273
CviJI RGCY 2 cut(s) 8, 252
CviKI_1 RGCY 2 cut(s) 8, 252
DdeI CTNAG 1 cut(s) 158
DpnI GATC 3 cut(s) 66, 140, 182
DpnII GATC 3 cut(s) 64, 138, 180
Eam1104I CTCTTC 2 cut(s) 53, 172
EarI CTCTTC 2 cut(s) 53, 172
EcoRII CCWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 276
FaiI YATR 4 cut(s) 153, 231, 245, 274
FatI CATG 1 cut(s) 272
Hin1II CATG 1 cut(s) 276
HphI GGTGA 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 1 cut(s) 273
HpyAV CCTTC 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 158
Hsp92II CATG 1 cut(s) 276
Kzo9I GATC 3 cut(s) 64, 138, 180
LpnPI CCDG 5 cut(s) 38, 65, 102, 137, 173
LweI GCATC 1 cut(s) 193
MaeIII GTNAC 1 cut(s) 256
MalI GATC 3 cut(s) 66, 140, 182
MboI GATC 3 cut(s) 64, 138, 180
MboII GAAGA 3 cut(s) 40, 139, 159
MflI RGATCY 1 cut(s) 180
MluCI AATT 2 cut(s) 191, 218
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 9 cut(s) 39, 56, 82, 119, 171, 175, 208, 242, 259
MseI TTAA 2 cut(s) 222, 237
MspR9I CCNGG 1 cut(s) 53
MvaI CCWGG 1 cut(s) 53
NdeII GATC 3 cut(s) 64, 138, 180
NlaIII CATG 1 cut(s) 276
NmuCI GTSAC 1 cut(s) 256
PagI TCATGA 1 cut(s) 272
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
PsuI RGATCY 1 cut(s) 180
SaqAI TTAA 2 cut(s) 222, 237
Sau3AI GATC 3 cut(s) 64, 138, 180
ScrFI CCNGG 1 cut(s) 53
SetI ASST 3 cut(s) 74, 111, 121
SfaNI GCATC 1 cut(s) 193
SgeI CNNG 6 cut(s) 64, 65, 129, 136, 187, 200
Sse9I AATT 2 cut(s) 191, 218
StyD4I CCNGG 1 cut(s) 51
TaqI TCGA 2 cut(s) 20, 141
TasI AATT 2 cut(s) 191, 218
Tru1I TTAA 2 cut(s) 222, 237
Tru9I TTAA 2 cut(s) 222, 237
TseFI GTSAC 1 cut(s) 256
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 2 cut(s) 17, 261
XapI RAATTY 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.