Rh3CG318500

Scaffold protein for the de novo synthesis of iron- sulfur (Fe-S) clusters within mitochondria, which is required for maturation of both mitochondrial and cytoplasmic 2Fe-2S and 4Fe-4S proteins

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
34102508 .. 34103436
929 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG318500.1

Sequence Viewer

Length: 324 bp
ATGAACTTGATGTCTTTAAGATTATGGAATGCTTTCTTTAAGGCTGGTAAATATGCAAAAGCTTCCAAATTGAAGCTGAAAGAGTACAAACAGGTTGAAAAGCTGATTTTGGTTGGTATCAGCATTGGAGTTTTTTGGAATGTTGTTCTTCCTGAAGGGTTGATTACCATCTTAGTAATTATGGTTCTCTTAGTCAAGCTACACTGCAGTATGCTTGCTGAGGATGCCATCAAGGCAGCTGTTAAAGACTATCAAACAAAGCTGGCTAAATCATCAAATGGCAGCTCAGAGGCCTCACCTGTGGAGAAGGCTGCTAATGCTTGA

Protein Analysis

107

Amino Acids

11.74

Weight (kDa)

9.64

Isoelectric Point (pI)

32.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019326)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 174
AfaI GTAC 1 cut(s) 86
AgsI TTSAA 2 cut(s) 73, 98
AluBI AGCT 7 cut(s) 62, 76, 103, 199, 239, 262, 285
AluI AGCT 7 cut(s) 62, 76, 103, 199, 239, 262, 285
AoxI GGCC 1 cut(s) 291
ApeKI GCWGC 3 cut(s) 236, 282, 311
Asp700I GAANNNNTTC 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 288
BbvCI CCTCAGC 1 cut(s) 219
BbvI GCAGC 3 cut(s) 248, 294, 298
BccI CCATC 2 cut(s) 176, 236
BfmI CTRYAG 1 cut(s) 205
BglI GCCNNNNNGGC 1 cut(s) 233
BisI GCNGC 3 cut(s) 237, 283, 312
BlsI GCNGC 3 cut(s) 238, 284, 313
BmsI GCATC 1 cut(s) 214
Bpu10I CCTNAGC 1 cut(s) 219
BsaBI GATNNNNATC 1 cut(s) 167
Bse8I GATNNNNATC 1 cut(s) 167
BseGI GGATG 1 cut(s) 229
BseJI GATNNNNATC 1 cut(s) 167
BseMII CTCAG 2 cut(s) 210, 300
BseXI GCAGC 3 cut(s) 248, 294, 298
BshFI GGCC 1 cut(s) 293
BsmI GAATGC 1 cut(s) 34
BsnI GGCC 1 cut(s) 293
BspANI GGCC 1 cut(s) 293
BspCNI CTCAG 2 cut(s) 211, 299
BspMAI CTGCAG 1 cut(s) 209
BstC8I GCNNGC 2 cut(s) 216, 264
BstDEI CTNAG 4 cut(s) 172, 190, 219, 286
BstF5I GGATG 1 cut(s) 229
BstMWI GCNNNNNNNGC 3 cut(s) 224, 233, 317
BstSFI CTRYAG 1 cut(s) 205
BstV1I GCAGC 3 cut(s) 248, 294, 298
BsuRI GGCC 1 cut(s) 293
BtsCI GGATG 1 cut(s) 229
BtsI GCAGTG 1 cut(s) 202
BtsIMutI CAGTG 1 cut(s) 202
Cac8I GCNNGC 2 cut(s) 216, 264
Csp6I GTAC 1 cut(s) 85
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 4 cut(s) 172, 190, 219, 286
Eco147I AGGCCT 1 cut(s) 293
Eco57I CTGAAG 1 cut(s) 174
FaiI YATR 4 cut(s) 25, 54, 182, 212
Fnu4HI GCNGC 3 cut(s) 237, 283, 312
FokI GGATG 1 cut(s) 236
Fsp4HI GCNGC 3 cut(s) 237, 283, 312
GluI GCNGC 3 cut(s) 237, 283, 312
HaeIII GGCC 1 cut(s) 293
HindIII AAGCTT 1 cut(s) 60
HphI GGTGA 1 cut(s) 288
Hpy188I TCNGA 1 cut(s) 289
Hpy188III TCNNGA 1 cut(s) 152
HpyAV CCTTC 2 cut(s) 149, 301
HpyCH4V TGCA 2 cut(s) 56, 207
HpyF10VI GCNNNNNNNGC 3 cut(s) 224, 233, 317
HpyF3I CTNAG 4 cut(s) 172, 190, 219, 286
LpnPI CCDG 5 cut(s) 30, 77, 165, 248, 312
Lsp1109I GCAGC 3 cut(s) 248, 294, 298
LweI GCATC 1 cut(s) 214
MboII GAAGA 1 cut(s) 140
MluCI AATT 2 cut(s) 68, 177
MnlI CCTC 3 cut(s) 214, 283, 304
MroXI GAANNNNTTC 1 cut(s) 32
MseI TTAA 3 cut(s) 17, 39, 243
MspA1I CMGCKG 1 cut(s) 239
Mva1269I GAATGC 1 cut(s) 34
MwoI GCNNNNNNNGC 3 cut(s) 224, 233, 317
PceI AGGCCT 1 cut(s) 293
PctI GAATGC 1 cut(s) 34
PdmI GAANNNNTTC 1 cut(s) 32
PkrI GCNGC 3 cut(s) 238, 284, 313
PsrI GAACNNNNNNTAC 2 cut(s) 168, 200
PstI CTGCAG 1 cut(s) 209
PvuII CAGCTG 1 cut(s) 239
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
SaqAI TTAA 3 cut(s) 17, 39, 243
SatI GCNGC 3 cut(s) 237, 283, 312
SetI ASST 9 cut(s) 64, 78, 96, 105, 201, 241, 264, 287, 301
SfaNI GCATC 1 cut(s) 214
SfcI CTRYAG 1 cut(s) 205
SgeI CNNG 9 cut(s) 19, 57, 104, 164, 208, 227, 244, 275, 311
Sse9I AATT 2 cut(s) 68, 177
SseBI AGGCCT 1 cut(s) 293
StuI AGGCCT 1 cut(s) 293
TasI AATT 2 cut(s) 68, 177
TatI WGTACW 1 cut(s) 84
Tru1I TTAA 3 cut(s) 17, 39, 243
Tru9I TTAA 3 cut(s) 17, 39, 243
TscAI CASTG 1 cut(s) 209
TseI GCWGC 3 cut(s) 236, 282, 311
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 209
XmnI GAANNNNTTC 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.