RchiOBHm_Chr2g0133981

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
50987597 .. 50990932
3336 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50507

Sequence Viewer

Length: 201 bp
ATGGAGAACTTACGAATAGGGCTGTGGAGACTGATATGCCAGTCATGGTTCAGTCAGATGGTAATCCATGCTCAAGAATTTAAAAAAAAAACGTCAAGTTATGTCATGCTTGGGTGTAGAATGGCGAGCATCTCCATGGTTACAGTTCTGAGGAGGTTAGGGTATGTCAAGTGTCTATTTGAGTGCTCTGTCCTGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.72

Weight (kDa)

9.62

Isoelectric Point (pI)

50.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 77
AjnI CCWGG 1 cut(s) 192
Alw21I GWGCWC 1 cut(s) 188
Alw26I GTCTC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 77
Bbv12I GWGCWC 1 cut(s) 188
BccI CCATC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 194
BcoDI GTCTC 1 cut(s) 22
Bme1390I CCNGG 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 57
BsaBI GATNNNNATC 1 cut(s) 62
BsaJI CCNNGG 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 40
Bse8I GATNNNNATC 1 cut(s) 62
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 1 cut(s) 135
BseJI GATNNNNATC 1 cut(s) 62
BseMII CTCAG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 40
BseRI GAGGAG 1 cut(s) 166
BsiHKAI GWGCWC 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 22
Bsp1286I GDGCHC 1 cut(s) 188
Bsp19I CCATGG 1 cut(s) 135
BspCNI CTCAG 1 cut(s) 141
BsrI ACTGG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 135
BssT1I CCWWGG 1 cut(s) 135
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 149
BstDSI CCRYGG 1 cut(s) 135
BstMAI GTCTC 1 cut(s) 22
BstNI CCWGG 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 192
BtgI CCRYGG 1 cut(s) 135
Cac8I GCNNGC 1 cut(s) 127
CviAII CATG 4 cut(s) 45, 68, 106, 136
CviJI RGCY 1 cut(s) 22
CviKI_1 RGCY 1 cut(s) 22
DdeI CTNAG 1 cut(s) 149
DraI TTTAAA 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 135
EcoRII CCWGG 1 cut(s) 192
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FaeI CATG 4 cut(s) 48, 71, 109, 139
FaiI YATR 8 cut(s) 37, 46, 69, 102, 107, 137, 165, 199
FatI CATG 4 cut(s) 44, 67, 105, 135
Hin1II CATG 4 cut(s) 48, 71, 109, 139
Hpy188I TCNGA 2 cut(s) 57, 150
Hpy188III TCNNGA 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 92
HpyF3I CTNAG 1 cut(s) 149
HpySE526I ACGT 1 cut(s) 92
Hsp92II CATG 4 cut(s) 48, 71, 109, 139
LpnPI CCDG 2 cut(s) 53, 179
LweI GCATC 1 cut(s) 138
MaeII ACGT 1 cut(s) 92
MaeIII GTNAC 1 cut(s) 139
MhlI GDGCHC 1 cut(s) 188
MluCI AATT 1 cut(s) 77
MnlI CCTC 2 cut(s) 144, 147
MseI TTAA 1 cut(s) 81
MslI CAYNNNNRTG 1 cut(s) 134
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NcoI CCATGG 1 cut(s) 135
NlaIII CATG 4 cut(s) 48, 71, 109, 139
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 134
SaqAI TTAA 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 194
SduI GDGCHC 1 cut(s) 188
SetI ASST 2 cut(s) 95, 158
SfaNI GCATC 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 134
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 192
StyI CCWWGG 1 cut(s) 135
TaaI ACNGT 1 cut(s) 145
TaiI ACGT 1 cut(s) 95
TasI AATT 1 cut(s) 77
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.