RchiOBHm_Chr2g0141291

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
58839798 .. 58842013
2216 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51160

Sequence Viewer

Length: 162 bp
ATGAAACCCCGCTTGATAGATGATGCCGCAGTAATCTCTCTCCCTCTCATCACAGATGCCCCATCAATTTCTCTTCCTCTGACGCCGCCTCATCTAGCCTTTCATCACGATTTTGGGTTGGAAATCGAAGCCTCACTCAAGCAAGGCTGCTTGGCGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.69

Weight (kDa)

5.27

Isoelectric Point (pI)

42.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018979)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 10, 27, 86
AcyI GRCGYC 1 cut(s) 83
ApeKI GCWGC 1 cut(s) 147
BbvI GCAGC 1 cut(s) 134
BccI CCATC 1 cut(s) 70
BfaI CTAG 1 cut(s) 95
BisI GCNGC 3 cut(s) 27, 86, 148
BlsI GCNGC 3 cut(s) 28, 87, 149
BmsI GCATC 2 cut(s) 13, 46
BpuEI CTTGAG 1 cut(s) 122
BsaHI GRCGYC 1 cut(s) 83
BseXI GCAGC 1 cut(s) 134
BspACI CCGC 3 cut(s) 10, 27, 86
BssNI GRCGYC 1 cut(s) 83
Bst6I CTCTTC 1 cut(s) 78
BstACI GRCGYC 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 134
CseI GACGC 1 cut(s) 91
CviJI RGCY 3 cut(s) 98, 131, 147
CviKI_1 RGCY 3 cut(s) 98, 131, 147
Eam1104I CTCTTC 1 cut(s) 78
EarI CTCTTC 1 cut(s) 78
FauI CCCGC 1 cut(s) 17
Fnu4HI GCNGC 3 cut(s) 27, 86, 148
Fsp4HI GCNGC 3 cut(s) 27, 86, 148
FspBI CTAG 1 cut(s) 95
GluI GCNGC 3 cut(s) 27, 86, 148
HgaI GACGC 1 cut(s) 91
Hin1I GRCGYC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 81
Hpy188III TCNNGA 1 cut(s) 107
Hsp92I GRCGYC 1 cut(s) 83
Lsp1109I GCAGC 1 cut(s) 134
LweI GCATC 2 cut(s) 13, 46
MaeI CTAG 1 cut(s) 95
MboII GAAGA 1 cut(s) 65
MluCI AATT 1 cut(s) 66
MmeI TCCRAC 1 cut(s) 99
MnlI CCTC 4 cut(s) 54, 87, 99, 142
PkrI GCNGC 3 cut(s) 28, 87, 149
SatI GCNGC 3 cut(s) 27, 86, 148
SfaNI GCATC 2 cut(s) 13, 46
SgeI CNNG 6 cut(s) 21, 25, 107, 119, 151, 155
SmlI CTYRAG 1 cut(s) 137
SmoI CTYRAG 1 cut(s) 137
Sse9I AATT 1 cut(s) 66
SsiI CCGC 3 cut(s) 10, 27, 86
SspMI CTAG 1 cut(s) 95
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 66
TauI GCSGC 2 cut(s) 29, 88
TseI GCWGC 1 cut(s) 147
TspDTI ATGAA 2 cut(s) 17, 92
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.