RchiOBHm_Chr6g0273411

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
34313625 .. 34316480
2856 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24528

Sequence Viewer

Length: 189 bp
ATGCCGCATCAGTCTCTCGATCTCCCTCTGATCACAGACGCCGCATCAGTCTCTCTCCTTCTGACGCCGCCTCACCTGCCTCGCATCAATCTCTCTCCCTCTAACGCTGCCTCTCATCACGATTTCGGGTTAGAAATCGAAGCCTCAATCAAGCAAGGCTACTTGGCAGTTTGGATATTCAGTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.72

Weight (kDa)

5.6

Isoelectric Point (pI)

55.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018979)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 84
Acc36I ACCTGC 1 cut(s) 84
AciI CCGC 3 cut(s) 5, 42, 68
AcyI GRCGYC 2 cut(s) 39, 65
AloI GAACNNNNNNTCC 1 cut(s) 166
Alw26I GTCTC 2 cut(s) 18, 55
ApeKI GCWGC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 65
BbvI GCAGC 1 cut(s) 94
BclI TGATCA 1 cut(s) 30
BcoDI GTCTC 2 cut(s) 18, 55
BfuAI ACCTGC 1 cut(s) 84
BisI GCNGC 4 cut(s) 5, 42, 68, 108
BlsI GCNGC 4 cut(s) 6, 43, 69, 109
BmsI GCATC 3 cut(s) 16, 53, 93
BsaHI GRCGYC 2 cut(s) 39, 65
BseXI GCAGC 1 cut(s) 94
BsmAI GTCTC 2 cut(s) 18, 55
Bsp143I GATC 2 cut(s) 19, 30
BspACI CCGC 3 cut(s) 5, 42, 68
BspMI ACCTGC 1 cut(s) 84
BssMI GATC 2 cut(s) 19, 30
BssNI GRCGYC 2 cut(s) 39, 65
BstACI GRCGYC 2 cut(s) 39, 65
BstKTI GATC 2 cut(s) 22, 33
BstMAI GTCTC 2 cut(s) 18, 55
BstMBI GATC 2 cut(s) 19, 30
BstMWI GCNNNNNNNGC 1 cut(s) 76
BstV1I GCAGC 1 cut(s) 94
BveI ACCTGC 1 cut(s) 84
CseI GACGC 2 cut(s) 47, 73
CviJI RGCY 2 cut(s) 143, 159
CviKI_1 RGCY 2 cut(s) 143, 159
DpnI GATC 2 cut(s) 21, 32
DpnII GATC 2 cut(s) 19, 30
FaiI YATR 1 cut(s) 187
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 4 cut(s) 5, 42, 68, 108
Fsp4HI GCNGC 4 cut(s) 5, 42, 68, 108
GluI GCNGC 4 cut(s) 5, 42, 68, 108
HgaI GACGC 2 cut(s) 47, 73
Hin1I GRCGYC 2 cut(s) 39, 65
HphI GGTGA 1 cut(s) 65
Hpy188I TCNGA 2 cut(s) 30, 63
Hpy188III TCNNGA 2 cut(s) 17, 119
HpyAV CCTTC 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
Hsp92I GRCGYC 2 cut(s) 39, 65
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 2 cut(s) 19, 30
LpnPI CCDG 1 cut(s) 89
Lsp1109I GCAGC 1 cut(s) 94
LweI GCATC 3 cut(s) 16, 53, 93
MalI GATC 2 cut(s) 21, 32
MboI GATC 2 cut(s) 19, 30
MnlI CCTC 6 cut(s) 36, 81, 90, 109, 121, 154
MwoI GCNNNNNNNGC 1 cut(s) 76
NdeII GATC 2 cut(s) 19, 30
PaqCI CACCTGC 1 cut(s) 84
PkrI GCNGC 4 cut(s) 6, 43, 69, 109
SatI GCNGC 4 cut(s) 5, 42, 68, 108
Sau3AI GATC 2 cut(s) 19, 30
SetI ASST 1 cut(s) 78
SfaNI GCATC 3 cut(s) 16, 53, 93
SgeI CNNG 8 cut(s) 29, 88, 93, 131, 139, 163, 167, 175
SsiI CCGC 3 cut(s) 5, 42, 68
TaqI TCGA 2 cut(s) 18, 138
TauI GCSGC 3 cut(s) 7, 44, 70
TseI GCWGC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.