RchiOBHm_Chr2g0172481

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
85796955 .. 85799951
2997 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53976

Sequence Viewer

Length: 189 bp
ATGGTATTCTTGCCTTCTTACACAGAAAGAGAAAGGCTTCTAAGGCTGCTCTTTGAGGCCCTTGAAAATTCAACTCGAGAACAGGATTCTCCACCAGAGCAGGGTTCTCCTCCAGAACAGTGCTTTCCTCCACAACAGCAACAAATCAATTCTGATCCCTTTTCTTCAGATTATGAGGGGAGCTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.19

Weight (kDa)

4.13

Isoelectric Point (pI)

84.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019336)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AcsI RAATTY 1 cut(s) 67
AcuI CTGAAG 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 2 cut(s) 65, 72
AluBI AGCT 1 cut(s) 183
AluI AGCT 1 cut(s) 183
AlwI GGATC 1 cut(s) 149
Ama87I CYCGRG 1 cut(s) 75
AoxI GGCC 1 cut(s) 57
ApeKI GCWGC 1 cut(s) 46
ApoI RAATTY 1 cut(s) 67
Asp700I GAANNNNTTC 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 58
AvaI CYCGRG 1 cut(s) 75
BbvI GCAGC 1 cut(s) 33
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
BmeT110I CYCGRG 1 cut(s) 75
BmgT120I GGNCC 1 cut(s) 58
BpmI CTGGAG 1 cut(s) 96
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseLI CCNNNNNNNGG 1 cut(s) 101
BseRI GAGGAG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 33
BshFI GGCC 1 cut(s) 59
BsiHKCI CYCGRG 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 101
BsnI GGCC 1 cut(s) 59
BsoBI CYCGRG 1 cut(s) 75
Bsp143I GATC 1 cut(s) 154
BspANI GGCC 1 cut(s) 59
BspPI GGATC 1 cut(s) 149
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 1 cut(s) 43
BstV1I GCAGC 1 cut(s) 33
BsuRI GGCC 1 cut(s) 59
BtsIMutI CAGTG 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 58
CviJI RGCY 4 cut(s) 37, 46, 59, 183
CviKI_1 RGCY 4 cut(s) 37, 46, 59, 183
DdeI CTNAG 1 cut(s) 41
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco57I CTGAAG 1 cut(s) 150
Eco88I CYCGRG 1 cut(s) 75
EcoO109I RGGNCCY 1 cut(s) 58
FaiI YATR 1 cut(s) 174
Fnu4HI GCNGC 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 47
GluI GCNGC 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 96
HaeIII GGCC 1 cut(s) 59
HinfI GANTC 1 cut(s) 86
Hpy188I TCNGA 3 cut(s) 154, 169, 188
Hpy188III TCNNGA 2 cut(s) 77, 113
HpyAV CCTTC 1 cut(s) 24
HpyCH4III ACNGT 1 cut(s) 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 41
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 1 cut(s) 180
LpnPI CCDG 4 cut(s) 68, 86, 108, 126
Lsp1109I GCAGC 1 cut(s) 33
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 1 cut(s) 156
MluCI AATT 2 cut(s) 67, 148
MnlI CCTC 4 cut(s) 49, 120, 138, 169
MroXI GAANNNNTTC 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 43
NdeII GATC 1 cut(s) 154
PaeR7I CTCGAG 1 cut(s) 75
PdmI GAANNNNTTC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 86
PkrI GCNGC 1 cut(s) 48
PspPI GGNCC 1 cut(s) 58
SatI GCNGC 1 cut(s) 47
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 58
SetI ASST 1 cut(s) 185
Sfr274I CTCGAG 1 cut(s) 75
SgeI CNNG 8 cut(s) 22, 74, 87, 89, 95, 107, 113, 125
SlaI CTCGAG 1 cut(s) 75
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 2 cut(s) 67, 148
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 76
TasI AATT 2 cut(s) 67, 148
TfiI GAWTC 1 cut(s) 86
TscAI CASTG 1 cut(s) 125
TseI GCWGC 1 cut(s) 46
TspRI CASTG 1 cut(s) 125
XapI RAATTY 1 cut(s) 67
XhoI CTCGAG 1 cut(s) 75
XmnI GAANNNNTTC 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.