Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0019924

Physical Location & Seq

Genomic Coordinates Forward (+)

52472835 .. 52476035

Gene Structure 3201 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ39613

Sequence Viewer

CDS Protein Promoter (2k)

Length: 135 bp

ATGGAACATCTACTACAGAAAGGTGGAGAAGATGTTTTGCCTGGGATTTCACAAACCTTATATTTTCCAAACATTGTAAATGTTCCTCTCTTCAAGGGATGCTCAACGGAATTCATCAATCAGATTGAGAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0005215 GO:0005216 GO:0005244 GO:0005249 GO:0005261 GO:0005267 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005886 GO:0005887 GO:0006810 GO:0006811 GO:0006812 GO:0006813 GO:0006950 GO:0008150 GO:0008324 GO:0009266 GO:0009409 GO:0009414 GO:0009415 GO:0009628 GO:0009719 GO:0009725 GO:0009737 GO:0009753 GO:0009987 GO:0010033 GO:0010035 GO:0015075 GO:0015077 GO:0015079 GO:0015267 GO:0015271 GO:0015318 GO:0015672 GO:0016020 GO:0016021 GO:0022803 GO:0022832 GO:0022836 GO:0022838 GO:0022839 GO:0022843 GO:0022857 GO:0022890 GO:0030001 GO:0031224 GO:0031226 GO:0033993 GO:0034220 GO:0042221 GO:0042391 GO:0042592 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044425 GO:0044459 GO:0044464 GO:0046873 GO:0048878 GO:0050801 GO:0050896 GO:0051179 GO:0051234 GO:0055065 GO:0055067 GO:0055075 GO:0055080 GO:0055085 GO:0065007 GO:0065008 GO:0071804 GO:0071805 GO:0071944 GO:0097305 GO:0098655 GO:0098660 GO:0098662 GO:0098771 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank_2 Ank_4 Ion_trans KHA cNMP_binding

Protein Analysis

44

Amino Acids

4.95

Weight (kDa)

4.96

Isoelectric Point (pI)

49.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019924)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0427181 RchiOBHm_Chr5g0051591
rosa_laevigata	RLG00000018359
rosa_roxburghii	Rroxscaffold_2G00121050
rosa_samantha	Rh4AG137900 Rh6BG508100 Rh7AG407600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	110
AgsI	TTSAA	1 cut(s)	94
AjnI	CCWGG	1 cut(s)	40
ApoI	RAATTY	1 cut(s)	110
BciT130I	CCWGG	1 cut(s)	42
BfmI	CTRYAG	1 cut(s)	14
Bme1390I	CCNGG	1 cut(s)	42
BmrFI	CCNGG	1 cut(s)	42
BmsI	GCATC	1 cut(s)	89
BsaJI	CCNNGG	1 cut(s)	41
BsaXI	ACNNNNNCTCC	2 cut(s)	18, 48
BseBI	CCWGG	1 cut(s)	42
BseDI	CCNNGG	1 cut(s)	41
BseGI	GGATG	1 cut(s)	104
BssECI	CCNNGG	1 cut(s)	41
Bst2UI	CCWGG	1 cut(s)	42
Bst6I	CTCTTC	1 cut(s)	95
BstF5I	GGATG	1 cut(s)	104
BstNI	CCWGG	1 cut(s)	42
BstSCI	CCNGG	1 cut(s)	40
BstSFI	CTRYAG	1 cut(s)	14
BtsCI	GGATG	1 cut(s)	104
Eam1104I	CTCTTC	1 cut(s)	95
EarI	CTCTTC	1 cut(s)	95
EcoRI	GAATTC	1 cut(s)	110
EcoRII	CCWGG	1 cut(s)	40
FaiI	YATR	1 cut(s)	61
FokI	GGATG	1 cut(s)	111
Hpy188I	TCNGA	1 cut(s)	123
LpnPI	CCDG	2 cut(s)	27, 54
LweI	GCATC	1 cut(s)	89
MboII	GAAGA	2 cut(s)	41, 82
MluCI	AATT	1 cut(s)	110
MnlI	CCTC	1 cut(s)	96
MspR9I	CCNGG	1 cut(s)	42
MvaI	CCWGG	1 cut(s)	42
Psp6I	CCWGG	1 cut(s)	40
PspGI	CCWGG	1 cut(s)	40
PsrI	GAACNNNNNNTAC	1 cut(s)	29
ScrFI	CCNGG	1 cut(s)	42
SetI	ASST	2 cut(s)	25, 59
SfaNI	GCATC	1 cut(s)	89
SfcI	CTRYAG	1 cut(s)	14
SgeI	CNNG	3 cut(s)	53, 54, 106
Sse9I	AATT	1 cut(s)	110
StyD4I	CCNGG	1 cut(s)	40
TasI	AATT	1 cut(s)	110
TspDTI	ATGAA	1 cut(s)	103
TspGWI	ACGGA	1 cut(s)	122
XapI	RAATTY	1 cut(s)	110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.