Rh4AG137900

Catalyzes the conversion of zeta-carotene to lycopene via the intermediary of neurosporene. It carries out two consecutive desaturations (introduction of double bonds) at positions C-7 and C-7'

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
35132610 .. 35133633
1024 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG137900.1

Sequence Viewer

Length: 327 bp
ATGCCACACCATAGCATGCCCTATCAACCAGGTGAACTTGATTTTCGGTTTCCAATTGGAGCCCCCATACATGGGATTCTTGCGTTTTTATCTACAAATCAGATCAAGACTTATGATAAAGCAAGAAATGCATTGGCTCTTGCATTGAGTCCTGTCGTCAGGGCTCTGGTTGATCCAGATGGAGCATTGAGTGATGTGCGGAATTTGGATAGCATAAGCTTCTCAGATTGGTTCATGTCCAAGGGTGGCACACGCACGAGTATCCAGAGAATAATACAGTGGATGATCAGGACACATGGTTTTCTAATAAGGAAGCCACGCTGTTGA

Protein Analysis

108

Amino Acids

12.18

Weight (kDa)

10.0

Isoelectric Point (pI)

31.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019924)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 199
AclWI GGATC 1 cut(s) 167
AcsI RAATTY 1 cut(s) 202
AfiI CCNNNNNNNGG 2 cut(s) 71, 72
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 1 cut(s) 219
AluI AGCT 1 cut(s) 219
AlwI GGATC 1 cut(s) 167
ApoI RAATTY 1 cut(s) 202
AsuHPI GGTGA 1 cut(s) 44
BanII GRGCYC 2 cut(s) 64, 166
BauI CACGAG 1 cut(s) 256
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 30
BciVI GTATCC 1 cut(s) 272
BclI TGATCA 1 cut(s) 285
BfuI GTATCC 1 cut(s) 272
Bme1390I CCNGG 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 240
Bsc4I CCNNNNNNNGG 2 cut(s) 71, 72
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 240
BseGI GGATG 1 cut(s) 288
BseLI CCNNNNNNNGG 2 cut(s) 71, 72
BseMII CTCAG 1 cut(s) 237
BslI CCNNNNNNNGG 2 cut(s) 71, 72
Bsp1286I GDGCHC 2 cut(s) 64, 166
Bsp143I GATC 3 cut(s) 102, 172, 285
BspACI CCGC 1 cut(s) 199
BspCNI CTCAG 1 cut(s) 236
BspLI GGNNCC 1 cut(s) 61
BspPI GGATC 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 3 cut(s) 102, 172, 285
BssSI CACGAG 1 cut(s) 256
BssT1I CCWWGG 1 cut(s) 240
Bst2BI CACGAG 1 cut(s) 256
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 279
BstAPI GCANNNNNTGC 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 223
BstF5I GGATG 1 cut(s) 288
BstKTI GATC 3 cut(s) 105, 175, 288
BstMBI GATC 3 cut(s) 102, 172, 285
BstMWI GCNNNNNNNGC 1 cut(s) 128
BstNI CCWGG 1 cut(s) 30
BstNSI RCATGY 1 cut(s) 19
BstSCI CCNGG 1 cut(s) 28
BsuI GTATCC 1 cut(s) 272
BtsCI GGATG 1 cut(s) 288
BtsIMutI CAGTG 1 cut(s) 284
Cac8I GCNNGC 1 cut(s) 17
CsiI ACCWGGT 1 cut(s) 28
CviAII CATG 4 cut(s) 16, 71, 235, 296
CviJI RGCY 5 cut(s) 62, 137, 164, 219, 316
CviKI_1 RGCY 5 cut(s) 62, 137, 164, 219, 316
DdeI CTNAG 1 cut(s) 223
DpnI GATC 3 cut(s) 104, 174, 287
DpnII GATC 3 cut(s) 102, 172, 285
Eco130I CCWWGG 1 cut(s) 240
Eco24I GRGCYC 2 cut(s) 64, 166
EcoRII CCWGG 1 cut(s) 28
EcoT14I CCWWGG 1 cut(s) 240
EcoT22I ATGCAT 1 cut(s) 133
EcoT38I GRGCYC 2 cut(s) 64, 166
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 4 cut(s) 19, 74, 238, 299
FaiI YATR 8 cut(s) 12, 17, 68, 72, 114, 215, 236, 297
FatI CATG 4 cut(s) 15, 70, 234, 295
FbaI TGATCA 1 cut(s) 285
FokI GGATG 1 cut(s) 295
FriOI GRGCYC 2 cut(s) 64, 166
Hin1II CATG 4 cut(s) 19, 74, 238, 299
HindIII AAGCTT 1 cut(s) 217
HinfI GANTC 2 cut(s) 76, 148
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 35
Hpy188I TCNGA 2 cut(s) 102, 226
Hpy188III TCNNGA 4 cut(s) 106, 176, 265, 289
Hpy8I GTNNAC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 279
HpyCH4V TGCA 2 cut(s) 131, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 223
Hsp92II CATG 4 cut(s) 19, 74, 238, 299
Ksp22I TGATCA 1 cut(s) 285
Kzo9I GATC 3 cut(s) 102, 172, 285
LmnI GCTCC 2 cut(s) 59, 182
LpnPI CCDG 8 cut(s) 15, 42, 145, 152, 165, 189, 274, 278
MabI ACCWGGT 1 cut(s) 28
MalI GATC 3 cut(s) 104, 174, 287
MboI GATC 3 cut(s) 102, 172, 285
MfeI CAATTG 1 cut(s) 54
MhlI GDGCHC 2 cut(s) 64, 166
MluCI AATT 2 cut(s) 54, 202
MlyI GAGTC 1 cut(s) 157
Mph1103I ATGCAT 1 cut(s) 133
MspR9I CCNGG 1 cut(s) 30
MunI CAATTG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 128
NdeII GATC 3 cut(s) 102, 172, 285
NlaIII CATG 4 cut(s) 19, 74, 238, 299
NlaIV GGNNCC 1 cut(s) 61
NsiI ATGCAT 1 cut(s) 133
NspI RCATGY 1 cut(s) 19
PaeI GCATGC 1 cut(s) 19
PfeI GAWTC 1 cut(s) 76
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 61
Sau3AI GATC 3 cut(s) 102, 172, 285
SchI GAGTC 1 cut(s) 157
ScrFI CCNGG 1 cut(s) 30
SduI GDGCHC 2 cut(s) 64, 166
SetI ASST 2 cut(s) 34, 221
SexAI ACCWGGT 1 cut(s) 28
SphI GCATGC 1 cut(s) 19
Sse9I AATT 2 cut(s) 54, 202
SsiI CCGC 1 cut(s) 199
StyD4I CCNGG 1 cut(s) 28
StyI CCWWGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 279
TasI AATT 2 cut(s) 54, 202
TfiI GAWTC 1 cut(s) 76
TscAI CASTG 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 223
TspRI CASTG 1 cut(s) 284
XapI RAATTY 1 cut(s) 202
XceI RCATGY 1 cut(s) 19
Zsp2I ATGCAT 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.