RchiOBHm_Chr5g0051591

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
52821041 .. 52826386
5346 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32905

Sequence Viewer

Length: 249 bp
ATGGAATTCATCAATCAGATTACCCTGAAGACCAGATCTGCCTATCCGGAGTCCAGAAGCGCATACATTATGTCTTTCACAATCTCAGACTCACCGATCTCAATCAATCTCCATCAAGACTTGGTCGAAAAGAGGAAATCTGTCGTTCTCACTCAAAAACAAAGTGACAGCCCCTCAGAGCAAATCACAAATGAGCTACTTAGTACTTATTACCACGGAAGATGTATCAACAGAGGACTAAACAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.41

Weight (kDa)

7.9

Isoelectric Point (pI)

67.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019924)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 46
AcsI RAATTY 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 47
AfaI GTAC 1 cut(s) 205
AluBI AGCT 1 cut(s) 196
AluI AGCT 1 cut(s) 196
Aor13HI TCCGGA 1 cut(s) 46
ApoI RAATTY 1 cut(s) 5
AspLEI GCGC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 84
BbsI GAAGAC 1 cut(s) 35
BccI CCATC 1 cut(s) 120
BglII AGATCT 1 cut(s) 35
BmcAI AGTACT 1 cut(s) 205
BpiI GAAGAC 1 cut(s) 35
BsaBI GATNNNNATC 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 214
BsaWI WCCGGW 1 cut(s) 46
Bse8I GATNNNNATC 1 cut(s) 101
BseAI TCCGGA 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 214
BseJI GATNNNNATC 1 cut(s) 101
BseMII CTCAG 2 cut(s) 99, 189
BsiSI CCGG 1 cut(s) 47
Bsp13I TCCGGA 1 cut(s) 46
Bsp143I GATC 2 cut(s) 35, 96
BspCNI CTCAG 2 cut(s) 98, 188
BspEI TCCGGA 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 214
BssMI GATC 2 cut(s) 35, 96
BstDEI CTNAG 3 cut(s) 85, 175, 200
BstDSI CCRYGG 1 cut(s) 214
BstHHI GCGC 1 cut(s) 62
BstKTI GATC 2 cut(s) 38, 99
BstMBI GATC 2 cut(s) 35, 96
BstV2I GAAGAC 1 cut(s) 35
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
BtgI CCRYGG 1 cut(s) 214
CfoI GCGC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 204
CviJI RGCY 2 cut(s) 171, 196
CviKI_1 RGCY 2 cut(s) 171, 196
CviQI GTAC 1 cut(s) 204
DdeI CTNAG 3 cut(s) 85, 175, 200
DpnI GATC 2 cut(s) 37, 98
DpnII GATC 2 cut(s) 35, 96
Eco57I CTGAAG 1 cut(s) 47
EcoRI GAATTC 1 cut(s) 5
FaiI YATR 2 cut(s) 64, 71
GlaI GCGC 1 cut(s) 61
HapII CCGG 1 cut(s) 47
HhaI GCGC 1 cut(s) 62
Hin6I GCGC 1 cut(s) 60
HinP1I GCGC 1 cut(s) 60
HinfI GANTC 2 cut(s) 50, 89
HpaII CCGG 1 cut(s) 47
HphI GGTGA 1 cut(s) 84
Hpy188I TCNGA 3 cut(s) 18, 88, 178
Hpy188III TCNNGA 3 cut(s) 47, 54, 116
HpyF3I CTNAG 3 cut(s) 85, 175, 200
HspAI GCGC 1 cut(s) 60
Kpn2I TCCGGA 1 cut(s) 46
Kzo9I GATC 2 cut(s) 35, 96
LpnPI CCDG 4 cut(s) 38, 46, 60, 67
MaeIII GTNAC 1 cut(s) 164
MalI GATC 2 cut(s) 37, 98
MboI GATC 2 cut(s) 35, 96
MboII GAAGA 2 cut(s) 40, 231
MflI RGATCY 1 cut(s) 35
MluCI AATT 1 cut(s) 5
MlyI GAGTC 2 cut(s) 59, 83
MnlI CCTC 3 cut(s) 126, 184, 227
MroI TCCGGA 1 cut(s) 46
MspI CCGG 1 cut(s) 47
NdeII GATC 2 cut(s) 35, 96
NmuCI GTSAC 1 cut(s) 164
PflFI GACNNNGTC 1 cut(s) 122
PleI GAGTC 2 cut(s) 58, 83
PpsI GAGTC 2 cut(s) 58, 83
PsuI RGATCY 1 cut(s) 35
PsyI GACNNNGTC 1 cut(s) 122
RsaI GTAC 1 cut(s) 205
RsaNI GTAC 1 cut(s) 204
Sau3AI GATC 2 cut(s) 35, 96
ScaI AGTACT 1 cut(s) 205
SchI GAGTC 2 cut(s) 59, 83
SetI ASST 1 cut(s) 198
SgeI CNNG 7 cut(s) 37, 45, 59, 66, 128, 133, 227
Sse9I AATT 1 cut(s) 5
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 5
TatI WGTACW 1 cut(s) 203
TseFI GTSAC 1 cut(s) 164
Tsp45I GTSAC 1 cut(s) 164
TspGWI ACGGA 1 cut(s) 231
Tth111I GACNNNGTC 1 cut(s) 122
XapI RAATTY 1 cut(s) 5
ZrmI AGTACT 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.