RchiOBHm_Chr6g0251181

Receptor-like protein 12

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
6494039 .. 6494359
321 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22519

Sequence Viewer

Length: 321 bp
ATGGAGGCAAACACAGATTCAAGTGAACCTATGGGTGATCAACAGTTTTACTACCATTACACCTTCTCAATCATGATAACAAAAAAAGGTGTTGAAAGATACTACGAGAAGATTCAACAAGACATGGGGGTCATTGATTTATCACGCAACAAATTTGAAGGGAAGATTCCTGCATTCATTGGGAACTTGAAAGGACTTCGCTTTCTTAATGTTTCCAACAACATTCTTAGTGACAGCATCCCATCGTTCTTGGGAAATTTGATATTACTTGAAGCATTGGACCTTTCATATAATGACCTCTCTAGAGAGATTTCTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.15

Weight (kDa)

4.84

Isoelectric Point (pI)

48.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020580)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0251181
rosa_laevigata RLG00000002144 RLG00000015476
rosa_multiflora Rmu_sc0004077.1_g000011 Rmu_sc0025980.1_g000001
rosa_samantha Rh1BG172500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 128
AcsI RAATTY 2 cut(s) 152, 256
AgsI TTSAA 6 cut(s) 21, 95, 116, 158, 190, 272
ApoI RAATTY 2 cut(s) 152, 256
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 280
BccI CCATC 1 cut(s) 250
BclI TGATCA 1 cut(s) 37
BfaI CTAG 1 cut(s) 303
Bme18I GGWCC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 280
BmsI GCATC 1 cut(s) 246
BseGI GGATG 1 cut(s) 237
BsmI GAATGC 1 cut(s) 173
Bsp143I GATC 1 cut(s) 37
BspHI TCATGA 1 cut(s) 72
BssMI GATC 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 227
BstF5I GGATG 1 cut(s) 237
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BtsCI GGATG 1 cut(s) 237
CciI TCATGA 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 280
CviAII CATG 2 cut(s) 73, 124
DdeI CTNAG 1 cut(s) 227
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
DrdI GACNNNNNNGTC 1 cut(s) 128
DseDI GACNNNNNNGTC 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 280
FaeI CATG 2 cut(s) 76, 127
FaiI YATR 5 cut(s) 32, 74, 125, 289, 291
FatI CATG 2 cut(s) 72, 123
FbaI TGATCA 1 cut(s) 37
FokI GGATG 1 cut(s) 224
FspBI CTAG 1 cut(s) 303
Hin1II CATG 2 cut(s) 76, 127
HinfI GANTC 3 cut(s) 17, 112, 166
HphI GGTGA 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 26
Hpy188III TCNNGA 2 cut(s) 73, 303
Hpy8I GTNNAC 1 cut(s) 26
HpyAV CCTTC 2 cut(s) 73, 152
HpyCH4III ACNGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 173
HpyF3I CTNAG 1 cut(s) 227
Hsp92II CATG 2 cut(s) 76, 127
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 183
LweI GCATC 1 cut(s) 246
MaeI CTAG 1 cut(s) 303
MaeIII GTNAC 1 cut(s) 230
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 2 cut(s) 121, 175
MluCI AATT 2 cut(s) 152, 256
MmeI TCCRAC 1 cut(s) 240
MnlI CCTC 1 cut(s) 308
MseI TTAA 1 cut(s) 207
Mva1269I GAATGC 1 cut(s) 173
NdeII GATC 1 cut(s) 37
NlaIII CATG 2 cut(s) 76, 127
NmuCI GTSAC 1 cut(s) 230
PagI TCATGA 1 cut(s) 72
PctI GAATGC 1 cut(s) 173
PfeI GAWTC 3 cut(s) 17, 112, 166
PspPI GGNCC 1 cut(s) 280
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 280
SetI ASST 5 cut(s) 31, 65, 91, 285, 300
SfaNI GCATC 1 cut(s) 246
SinI GGWCC 1 cut(s) 280
Sse9I AATT 2 cut(s) 152, 256
SspMI CTAG 1 cut(s) 303
TaaI ACNGT 1 cut(s) 45
TasI AATT 2 cut(s) 152, 256
TfiI GAWTC 3 cut(s) 17, 112, 166
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseFI GTSAC 1 cut(s) 230
Tsp45I GTSAC 1 cut(s) 230
TspDTI ATGAA 2 cut(s) 166, 276
VpaK11BI GGWCC 1 cut(s) 280
XapI RAATTY 2 cut(s) 152, 256
XbaI TCTAGA 1 cut(s) 302
XspI CTAG 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.