RchiOBHm_Chr6g0261331

protein phosphatase 2C 39

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0019167
Physical Location & Seq
Forward (+)
16222810 .. 16225470
2661 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23436

Sequence Viewer

Length: 210 bp
ATGAAGGAAAAAGTTTTAGGTCCATCGGACCCTGACTCTGGCAAAGGGGATGTACCACGTGTTGATGGGCAGTTGGCTGTAGCACGGGCATTCGGTGACAAGAGCTTGAAGAAACATTTAAGTTCTCAACCTTTTGTGATGTCGGAGACGATAGATGATGAGACACAGTTTGCTGTCTTAGCAAGTGATGGACTGTGGAAGGTTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2C

Protein Analysis

69

Amino Acids

7.39

Weight (kDa)

5.14

Isoelectric Point (pI)

26.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C PF00481 18 - 68 3.8e-15 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019167)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G34740 AT2G34740 AT2G34740
fragaria_vesca FvH4_3g10800
malus_domestica MD10G1247400.v1.1
prunus_persica Prupe.4G095900_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0261331
rosa_wichuraiana Rw5G011290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcvI CACGTG 1 cut(s) 59
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 38
AflIII ACRYGT 1 cut(s) 58
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw26I GTCTC 2 cut(s) 140, 155
AspS9I GGNCC 2 cut(s) 20, 28
AsuHPI GGTGA 1 cut(s) 107
AvaII GGWCC 2 cut(s) 20, 28
BbrPI CACGTG 1 cut(s) 59
BccI CCATC 3 cut(s) 31, 59, 182
BcoDI GTCTC 2 cut(s) 140, 155
BfmI CTRYAG 1 cut(s) 78
Bme18I GGWCC 2 cut(s) 20, 28
BmgT120I GGNCC 2 cut(s) 20, 28
BmiI GGNNCC 1 cut(s) 30
BsaAI YACGTR 1 cut(s) 59
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 2 cut(s) 140, 155
BsmBI CGTCTC 1 cut(s) 140
BsmI GAATGC 1 cut(s) 89
BspLI GGNNCC 1 cut(s) 30
Bst4CI ACNGT 2 cut(s) 168, 195
BstBAI YACGTR 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 178
BstF5I GGATG 1 cut(s) 55
BstMAI GTCTC 2 cut(s) 140, 155
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstSFI CTRYAG 1 cut(s) 78
BtsCI GGATG 1 cut(s) 55
Cfr13I GGNCC 2 cut(s) 20, 28
Csp6I GTAC 1 cut(s) 53
CviJI RGCY 2 cut(s) 77, 105
CviKI_1 RGCY 2 cut(s) 77, 105
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 178
Eco47I GGWCC 2 cut(s) 20, 28
Eco72I CACGTG 1 cut(s) 59
Esp3I CGTCTC 1 cut(s) 140
FokI GGATG 1 cut(s) 62
HinfI GANTC 1 cut(s) 35
HphI GGTGA 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 28, 145
HpyAV CCTTC 1 cut(s) 193
HpyCH4III ACNGT 2 cut(s) 168, 195
HpyCH4IV ACGT 1 cut(s) 58
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
HpyF3I CTNAG 1 cut(s) 178
HpySE526I ACGT 1 cut(s) 58
LpnPI CCDG 2 cut(s) 24, 45
MaeII ACGT 1 cut(s) 58
MaeIII GTNAC 1 cut(s) 95
MboII GAAGA 1 cut(s) 121
MlyI GAGTC 1 cut(s) 29
MmeI TCCRAC 1 cut(s) 123
MseI TTAA 2 cut(s) 119, 208
Mva1269I GAATGC 1 cut(s) 89
MwoI GCNNNNNNNGC 1 cut(s) 179
NlaIV GGNNCC 1 cut(s) 30
NmuCI GTSAC 1 cut(s) 95
PctI GAATGC 1 cut(s) 89
PleI GAGTC 1 cut(s) 29
PmaCI CACGTG 1 cut(s) 59
PmlI CACGTG 1 cut(s) 59
PpsI GAGTC 1 cut(s) 29
Ppu21I YACGTR 1 cut(s) 59
PspCI CACGTG 1 cut(s) 59
PspN4I GGNNCC 1 cut(s) 30
PspPI GGNCC 2 cut(s) 20, 28
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SaqAI TTAA 2 cut(s) 119, 208
Sau96I GGNCC 2 cut(s) 20, 28
SchI GAGTC 1 cut(s) 29
SetI ASST 5 cut(s) 22, 61, 107, 133, 204
SfcI CTRYAG 1 cut(s) 78
SgeI CNNG 9 cut(s) 44, 51, 69, 71, 96, 98, 112, 118, 195
SinI GGWCC 2 cut(s) 20, 28
TaaI ACNGT 2 cut(s) 168, 195
TaiI ACGT 1 cut(s) 61
Tru1I TTAA 2 cut(s) 119, 208
Tru9I TTAA 2 cut(s) 119, 208
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 20, 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.