RchiOBHm_Chr6g0266591

ALA-interacting subunit 3-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
23096118 .. 23098175
2058 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23909

Sequence Viewer

Length: 273 bp
ATGGAACGACTTATGGGAGTTGCACGTCTTCTATCACAGGTGTTTCTTGCTTTATCATATGAATTCGGTTTTATCTTCTTTAATTGCAGTTGTTGTATGGTTAACATTGTTGTTGGAGTGGTTGATCGATATAAAATTGATTGCATATCAGTGTCCTCTAGAAGTGTTAAGGTCATATACATCCAGACCTCGGGAAATAAAACATGCAATAGAAATCTGATGGAATCCATAGTGAATATTGATCGATCTACCAATGACATGAATAGCAAGTAG

Protein Analysis

90

Amino Acids

10.19

Weight (kDa)

8.7

Isoelectric Point (pI)

35.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018928)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 190
AjiI CACGTC 1 cut(s) 26
Ama87I CYCGRG 1 cut(s) 190
ApoI RAATTY 1 cut(s) 62
AvaI CYCGRG 1 cut(s) 190
BbsI GAAGAC 1 cut(s) 20
BccI CCATC 1 cut(s) 214
BfaI CTAG 1 cut(s) 159
BmeT110I CYCGRG 1 cut(s) 190
BmgBI CACGTC 1 cut(s) 26
BpiI GAAGAC 1 cut(s) 20
Bsa29I ATCGAT 2 cut(s) 127, 244
BsaJI CCNNGG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 190
BseCI ATCGAT 2 cut(s) 127, 244
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 180
BseLI CCNNNNNNNGG 1 cut(s) 190
BshVI ATCGAT 2 cut(s) 127, 244
BsiHKCI CYCGRG 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 190
BsoBI CYCGRG 1 cut(s) 190
Bsp143I GATC 3 cut(s) 124, 241, 245
BspDI ATCGAT 2 cut(s) 127, 244
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 3 cut(s) 124, 241, 245
BstF5I GGATG 1 cut(s) 180
BstKTI GATC 3 cut(s) 127, 244, 248
BstMBI GATC 3 cut(s) 124, 241, 245
BstNSI RCATGY 1 cut(s) 207
BstV2I GAAGAC 1 cut(s) 20
Bsu15I ATCGAT 2 cut(s) 127, 244
BsuTUI ATCGAT 2 cut(s) 127, 244
BtrI CACGTC 1 cut(s) 26
BtsCI GGATG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 156
ClaI ATCGAT 2 cut(s) 127, 244
CviAII CATG 2 cut(s) 204, 259
DpnI GATC 3 cut(s) 126, 243, 247
DpnII GATC 3 cut(s) 124, 241, 245
Eco88I CYCGRG 1 cut(s) 190
EcoRI GAATTC 1 cut(s) 62
FaeI CATG 2 cut(s) 207, 262
FatI CATG 2 cut(s) 203, 258
FauNDI CATATG 1 cut(s) 58
FokI GGATG 1 cut(s) 167
FspBI CTAG 1 cut(s) 159
Hin1II CATG 2 cut(s) 207, 262
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
HinfI GANTC 1 cut(s) 224
HpaI GTTAAC 1 cut(s) 103
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 3 cut(s) 159, 184, 192
Hpy8I GTNNAC 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 25
HpyCH4V TGCA 4 cut(s) 23, 87, 144, 207
HpySE526I ACGT 1 cut(s) 25
Hsp92II CATG 2 cut(s) 207, 262
KspAI GTTAAC 1 cut(s) 103
Kzo9I GATC 3 cut(s) 124, 241, 245
LpnPI CCDG 2 cut(s) 23, 197
MaeI CTAG 1 cut(s) 159
MaeII ACGT 1 cut(s) 25
MalI GATC 3 cut(s) 126, 243, 247
MboI GATC 3 cut(s) 124, 241, 245
MboII GAAGA 2 cut(s) 20, 67
MluCI AATT 3 cut(s) 62, 82, 135
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 2 cut(s) 166, 199
MseI TTAA 3 cut(s) 81, 102, 168
MslI CAYNNNNRTG 1 cut(s) 149
NdeI CATATG 1 cut(s) 58
NdeII GATC 3 cut(s) 124, 241, 245
NlaIII CATG 2 cut(s) 207, 262
NspI RCATGY 1 cut(s) 207
PfeI GAWTC 1 cut(s) 224
RseI CAYNNNNRTG 1 cut(s) 149
SaqAI TTAA 3 cut(s) 81, 102, 168
Sau3AI GATC 3 cut(s) 124, 241, 245
SetI ASST 4 cut(s) 28, 42, 174, 191
SgeI CNNG 8 cut(s) 36, 50, 59, 171, 196, 202, 204, 216
SmiMI CAYNNNNRTG 1 cut(s) 149
Sse9I AATT 3 cut(s) 62, 82, 135
SspI AATATT 1 cut(s) 238
SspMI CTAG 1 cut(s) 159
TaiI ACGT 1 cut(s) 28
TaqI TCGA 2 cut(s) 127, 244
TasI AATT 3 cut(s) 62, 82, 135
TfiI GAWTC 1 cut(s) 224
Tru1I TTAA 3 cut(s) 81, 102, 168
Tru9I TTAA 3 cut(s) 81, 102, 168
TscAI CASTG 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 75
TspRI CASTG 1 cut(s) 156
XapI RAATTY 1 cut(s) 62
XbaI TCTAGA 1 cut(s) 158
XceI RCATGY 1 cut(s) 207
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.