RchiOBHm_Chr7g0198471

Cop9 signalosome complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
16362467 .. 16366763
4297 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17757

Sequence Viewer

Length: 180 bp
ATGAATATTACAAATCTGATCAAAGAATGCATAAGAATGGGCTACAATGATTTTGGAGATTTCCATTATTCTCATGGCAACTTGGGGATGCTTTTAAGAGCTATGTTTGTACTCCTGATTATTGTCCTACATCAAAGCATACTGTTCATATGTGCATGTGTTCCATTCTGGTCAGCATAG

Protein Analysis

59

Amino Acids

6.79

Weight (kDa)

6.8

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015176)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 111
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
BclI TGATCA 1 cut(s) 18
BmsI GCATC 1 cut(s) 78
BseGI GGATG 1 cut(s) 93
BsmI GAATGC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 18
BssMI GATC 1 cut(s) 18
Bst4CI ACNGT 1 cut(s) 144
BstF5I GGATG 1 cut(s) 93
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstNSI RCATGY 1 cut(s) 159
BtsCI GGATG 1 cut(s) 93
Csp6I GTAC 1 cut(s) 110
CviAII CATG 2 cut(s) 74, 156
CviJI RGCY 2 cut(s) 42, 101
CviKI_1 RGCY 2 cut(s) 42, 101
CviQI GTAC 1 cut(s) 110
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
EcoT22I ATGCAT 1 cut(s) 32
FaeI CATG 2 cut(s) 77, 159
FaiI YATR 8 cut(s) 32, 75, 104, 140, 149, 151, 157, 178
FatI CATG 2 cut(s) 73, 155
FauNDI CATATG 1 cut(s) 149
FbaI TGATCA 1 cut(s) 18
FokI GGATG 1 cut(s) 100
Hin1II CATG 2 cut(s) 77, 159
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 144
HpyCH4V TGCA 2 cut(s) 30, 155
Hsp92II CATG 2 cut(s) 77, 159
Ksp22I TGATCA 1 cut(s) 18
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 2 cut(s) 128, 154
LweI GCATC 1 cut(s) 78
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
Mph1103I ATGCAT 1 cut(s) 32
MseI TTAA 1 cut(s) 95
MslI CAYNNNNRTG 1 cut(s) 35
Mva1269I GAATGC 1 cut(s) 32
NdeI CATATG 1 cut(s) 149
NdeII GATC 1 cut(s) 18
NlaIII CATG 2 cut(s) 77, 159
NsiI ATGCAT 1 cut(s) 32
NspI RCATGY 1 cut(s) 159
PctI GAATGC 1 cut(s) 32
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
RseI CAYNNNNRTG 1 cut(s) 35
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 1 cut(s) 18
SetI ASST 1 cut(s) 103
SfaNI GCATC 1 cut(s) 78
SgeI CNNG 4 cut(s) 86, 94, 127, 168
SmiMI CAYNNNNRTG 1 cut(s) 35
SspI AATATT 1 cut(s) 7
TaaI ACNGT 1 cut(s) 144
TatI WGTACW 1 cut(s) 109
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 2 cut(s) 17, 136
XceI RCATGY 1 cut(s) 159
XcmI CCANNNNNNNNNTGG 1 cut(s) 71
Zsp2I ATGCAT 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.