RchiOBHm_Chr7g0220901

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
41836829 .. 41838811
1983 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19770

Sequence Viewer

Length: 150 bp
ATGTCCAAGTTTGTGAACTTTTGGGTAGCCCATATTTGGGGGAGGTTCTGCCGAATTTTCGGTAGAATTTCGCTTAACGTGGGCCCCGCAGGCTCGTATCCAGGACTTCTGGGTGTTCTTGGGTCGGGTCCTATCAACCTAAACGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.35

Weight (kDa)

10.04

Isoelectric Point (pI)

23.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018784)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g22321 FvH4_3g30191 FvH4_3g31746 FvH4_3g31746
pyrus_communis pycom09g05880
rosa_chinensis RchiOBHm_Chr7g0220901
rosa_multiflora Rmu_sc0000756.1_g000011
rosa_roxburghii Rroxscaffold_2G00094810
rosa_samantha Rh5BG308800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 87
AcsI RAATTY 2 cut(s) 54, 66
AfiI CCNNNNNNNGG 2 cut(s) 36, 37
AjnI CCWGG 1 cut(s) 100
AoxI GGCC 1 cut(s) 82
ApaI GGGCCC 1 cut(s) 86
ApoI RAATTY 2 cut(s) 54, 66
AspS9I GGNCC 3 cut(s) 82, 83, 128
AvaII GGWCC 1 cut(s) 128
BaeGI GKGCMC 1 cut(s) 86
BanII GRGCYC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 102
BciVI GTATCC 1 cut(s) 108
BfuI GTATCC 1 cut(s) 108
BglI GCCNNNNNGGC 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 3 cut(s) 82, 83, 128
BmiI GGNNCC 3 cut(s) 84, 85, 129
BmrFI CCNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 37
BseBI CCWGG 1 cut(s) 102
BseLI CCNNNNNNNGG 2 cut(s) 36, 37
BseSI GKGCMC 1 cut(s) 86
BshFI GGCC 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 36, 37
BsnI GGCC 1 cut(s) 84
Bsp120I GGGCCC 1 cut(s) 82
Bsp1286I GDGCHC 1 cut(s) 86
BspACI CCGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 84
BspLI GGNNCC 3 cut(s) 84, 85, 129
Bst2UI CCWGG 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 90
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstSLI GKGCMC 1 cut(s) 86
BsuI GTATCC 1 cut(s) 108
BsuRI GGCC 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 91
Cfr13I GGNCC 3 cut(s) 82, 83, 128
CviJI RGCY 3 cut(s) 29, 84, 93
CviKI_1 RGCY 3 cut(s) 29, 84, 93
Eco24I GRGCYC 1 cut(s) 86
Eco47I GGWCC 1 cut(s) 128
EcoO109I RGGNCCY 2 cut(s) 83, 128
EcoRII CCWGG 1 cut(s) 100
EcoT38I GRGCYC 1 cut(s) 86
FaiI YATR 1 cut(s) 33
FauI CCCGC 1 cut(s) 94
FriOI GRGCYC 1 cut(s) 86
HaeIII GGCC 1 cut(s) 84
Hpy166II GTNNAC 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 16
HpyCH4IV ACGT 1 cut(s) 78
HpyF10VI GCNNNNNNNGC 1 cut(s) 90
HpySE526I ACGT 1 cut(s) 78
LpnPI CCDG 4 cut(s) 75, 87, 95, 114
MaeII ACGT 1 cut(s) 78
MhlI GDGCHC 1 cut(s) 86
MluCI AATT 2 cut(s) 54, 66
MnlI CCTC 1 cut(s) 36
MseI TTAA 1 cut(s) 75
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 90
NlaIV GGNNCC 3 cut(s) 84, 85, 129
PfoI TCCNGGA 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 128
Psp5II RGGWCCY 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspN4I GGNNCC 3 cut(s) 84, 85, 129
PspOMI GGGCCC 1 cut(s) 82
PspPI GGNCC 3 cut(s) 82, 83, 128
PspPPI RGGWCCY 1 cut(s) 128
SaqAI TTAA 1 cut(s) 75
Sau96I GGNCC 3 cut(s) 82, 83, 128
ScrFI CCNGG 1 cut(s) 102
SduI GDGCHC 1 cut(s) 86
SetI ASST 3 cut(s) 47, 81, 141
SinI GGWCC 1 cut(s) 128
Sse9I AATT 2 cut(s) 54, 66
SsiI CCGC 1 cut(s) 87
StyD4I CCNGG 1 cut(s) 100
TaiI ACGT 1 cut(s) 81
TasI AATT 2 cut(s) 54, 66
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 2 cut(s) 54, 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.