RLG00000001207

Zinc-finger of C2H2 type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0017315
Physical Location & Seq
Forward (+)
11998425 .. 12000249
1825 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001207

Sequence Viewer

Length: 534 bp
ATGGGTTGGCTAGTTTTTCTAAAGCTCTCAGCAAAGTTTTTCACTGTTGTTCTTTCCTGGCCTTCGTTTAGTTTGGTTTATGCCCTGTATGCTTCCATTCAGGCCGTTCAGAGTGACTCTCACTCCAGAAATCAGCGATGTCTTGCTTACTGGGTTTTGTTTGCTTTATACAAAATCTCAGAGTCAACGCTTGCAAAGCTTTTCTATTGGCTTCCACTATCGCCTTATACAAAGGGTGTCATTACGGTCCTTCTGGTGTTACCCTACTTCCATGGTGCTTCTTATCTGTATGAGCATTCTATTAGGTCCTATATTGCTGAGTATTCATTTATCTGGAAATGGAACTTCTTGTCCATACCAAGGGTAGAAGGTATCTTTTCGAGGGAGGACAGCCATCTTGATGTGGTTGATAAAAGTGTTATCAGGGTTGAACCACAAGAATCAGTGAGACCTGTCATGTTGCAGTTTAGAAATTATAAATTGCGAAGGCGTCATGGAAAAAGGGCCTCCCTCTTTTATGACCAGTTGTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 TB2_DP1_HVA22 zf-met

Protein Analysis

178

Amino Acids

20.97

Weight (kDa)

9.65

Isoelectric Point (pI)

47.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TB2_DP1_HVA22 PF03134 29 - 103 9.4e-18 TB2/DP1, HVA22 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017315)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g34302 FvH4_5g34302 FvH4_5g34302
prunus_persica Prupe.1G535200_v2.0.a1 Prupe.1G535200_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0234881
rosa_laevigata RLG00000001207
rosa_roxburghii Rroxscaffold_3G00226680
rosa_samantha Rh7AG440600 Rh7BG413400 Rh7CG462300 Rh7DG430300
rosa_wichuraiana Rw7G036630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 477
AcyI GRCGYC 1 cut(s) 490
AfaI GTAC 1 cut(s) 530
AfiI CCNNNNNNNGG 1 cut(s) 360
AgsI TTSAA 1 cut(s) 431
AjnI CCWGG 1 cut(s) 56
AloI GAACNNNNNNTCC 2 cut(s) 335, 367
AluBI AGCT 2 cut(s) 25, 199
AluI AGCT 2 cut(s) 25, 199
Alw26I GTCTC 1 cut(s) 442
AoxI GGCC 3 cut(s) 59, 102, 504
AspS9I GGNCC 3 cut(s) 247, 306, 504
AvaII GGWCC 2 cut(s) 247, 306
BccI CCATC 1 cut(s) 402
BceAI ACGGC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 58
BcoDI GTCTC 1 cut(s) 442
BfaI CTAG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 2 cut(s) 247, 306
BmgT120I GGNCC 3 cut(s) 247, 306, 504
BmrFI CCNGG 1 cut(s) 58
BmrI ACTGGG 1 cut(s) 160
BmuI ACTGGG 1 cut(s) 160
BplI GAGNNNNNCTC 2 cut(s) 103, 135
BpmI CTGGAG 1 cut(s) 109
BsaHI GRCGYC 1 cut(s) 490
BsaI GGTCTC 1 cut(s) 442
BsaJI CCNNGG 2 cut(s) 271, 359
BsaXI ACNNNNNCTCC 2 cut(s) 107, 137
Bsc4I CCNNNNNNNGG 1 cut(s) 360
Bse1I ACTGG 2 cut(s) 155, 523
BseBI CCWGG 1 cut(s) 58
BseDI CCNNGG 2 cut(s) 271, 359
BseLI CCNNNNNNNGG 1 cut(s) 360
BseMII CTCAG 3 cut(s) 42, 192, 309
BseNI ACTGG 2 cut(s) 155, 523
BshFI GGCC 3 cut(s) 61, 104, 506
BslI CCNNNNNNNGG 1 cut(s) 360
BsmAI GTCTC 1 cut(s) 442
BsmI GAATGC 1 cut(s) 295
BsnI GGCC 3 cut(s) 61, 104, 506
Bso31I GGTCTC 1 cut(s) 442
Bsp19I CCATGG 1 cut(s) 271
BspANI GGCC 3 cut(s) 61, 104, 506
BspCNI CTCAG 3 cut(s) 41, 191, 310
BspTNI GGTCTC 1 cut(s) 442
BsrI ACTGG 2 cut(s) 155, 523
BssECI CCNNGG 2 cut(s) 271, 359
BssNI GRCGYC 1 cut(s) 490
BssT1I CCWWGG 2 cut(s) 271, 359
Bst2UI CCWGG 1 cut(s) 58
Bst4CI ACNGT 2 cut(s) 46, 247
BstACI GRCGYC 1 cut(s) 490
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 3 cut(s) 28, 178, 318
BstDSI CCRYGG 1 cut(s) 271
BstMAI GTCTC 1 cut(s) 442
BstMWI GCNNNNNNNGC 2 cut(s) 89, 196
BstNI CCWGG 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 56
BsuRI GGCC 3 cut(s) 61, 104, 506
BtgI CCRYGG 1 cut(s) 271
BtgZI GCGATG 1 cut(s) 151
BtsIMutI CAGTG 2 cut(s) 42, 450
Cac8I GCNNGC 1 cut(s) 192
Cfr13I GGNCC 3 cut(s) 247, 306, 504
CseI GACGC 1 cut(s) 479
Csp6I GTAC 1 cut(s) 529
CviAII CATG 3 cut(s) 272, 457, 494
CviJI RGCY 8 cut(s) 10, 25, 61, 104, 199, 211, 393, 506
CviKI_1 RGCY 8 cut(s) 10, 25, 61, 104, 199, 211, 393, 506
CviQI GTAC 1 cut(s) 529
DdeI CTNAG 3 cut(s) 28, 178, 318
Eco130I CCWWGG 2 cut(s) 271, 359
Eco31I GGTCTC 1 cut(s) 442
Eco47I GGWCC 2 cut(s) 247, 306
EcoO109I RGGNCCY 2 cut(s) 306, 504
EcoRII CCWGG 1 cut(s) 56
EcoT14I CCWWGG 2 cut(s) 271, 359
ErhI CCWWGG 2 cut(s) 271, 359
FaeI CATG 3 cut(s) 275, 460, 497
FatI CATG 3 cut(s) 271, 456, 493
FspBI CTAG 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 109
HaeIII GGCC 3 cut(s) 61, 104, 506
HgaI GACGC 1 cut(s) 479
Hin1I GRCGYC 1 cut(s) 490
Hin1II CATG 3 cut(s) 275, 460, 497
HincII GTYRAC 1 cut(s) 186
HindII GTYRAC 1 cut(s) 186
HindIII AAGCTT 1 cut(s) 197
HinfI GANTC 3 cut(s) 116, 182, 440
Hpy166II GTNNAC 1 cut(s) 186
Hpy188I TCNGA 2 cut(s) 111, 181
Hpy188III TCNNGA 3 cut(s) 126, 334, 398
Hpy8I GTNNAC 1 cut(s) 186
HpyAV CCTTC 4 cut(s) 72, 260, 362, 480
HpyCH4III ACNGT 2 cut(s) 46, 247
HpyCH4V TGCA 2 cut(s) 194, 463
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 196
HpyF3I CTNAG 3 cut(s) 28, 178, 318
Hsp92I GRCGYC 1 cut(s) 490
Hsp92II CATG 3 cut(s) 275, 460, 497
MaeI CTAG 1 cut(s) 11
MaeIII GTNAC 2 cut(s) 113, 258
MluCI AATT 2 cut(s) 472, 479
MlyI GAGTC 2 cut(s) 110, 191
MnlI CCTC 4 cut(s) 375, 379, 517, 521
MslI CAYNNNNRTG 1 cut(s) 399
MspR9I CCNGG 1 cut(s) 58
Mva1269I GAATGC 1 cut(s) 295
MvaI CCWGG 1 cut(s) 58
MwoI GCNNNNNNNGC 2 cut(s) 89, 196
NcoI CCATGG 1 cut(s) 271
NlaIII CATG 3 cut(s) 275, 460, 497
NmuCI GTSAC 1 cut(s) 113
PctI GAATGC 1 cut(s) 295
PfeI GAWTC 1 cut(s) 440
PleI GAGTC 2 cut(s) 110, 190
PpsI GAGTC 2 cut(s) 110, 190
PpuMI RGGWCCY 1 cut(s) 306
PsiI TTATAA 1 cut(s) 477
Psp5II RGGWCCY 1 cut(s) 306
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 3 cut(s) 247, 306, 504
PspPPI RGGWCCY 1 cut(s) 306
RsaI GTAC 1 cut(s) 530
RsaNI GTAC 1 cut(s) 529
RseI CAYNNNNRTG 1 cut(s) 399
Sau96I GGNCC 3 cut(s) 247, 306, 504
SchI GAGTC 2 cut(s) 110, 191
ScrFI CCNGG 1 cut(s) 58
SetI ASST 5 cut(s) 27, 201, 308, 373, 454
SinI GGWCC 2 cut(s) 247, 306
SmiMI CAYNNNNRTG 1 cut(s) 399
Sse9I AATT 2 cut(s) 472, 479
SspMI CTAG 1 cut(s) 11
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 2 cut(s) 271, 359
TaaI ACNGT 2 cut(s) 46, 247
TaqI TCGA 1 cut(s) 380
TasI AATT 2 cut(s) 472, 479
TatI WGTACW 1 cut(s) 528
TfiI GAWTC 1 cut(s) 440
TscAI CASTG 2 cut(s) 49, 450
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 315
TspRI CASTG 2 cut(s) 49, 450
VpaK11BI GGWCC 2 cut(s) 247, 306
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.