RLG00000002274

Belongs to the nucleosome assembly protein (NAP) family

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
31197246 .. 31197721
476 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000002274

Sequence Viewer

Length: 402 bp
ATGGCAATGATGCATCATTACATACTTGCTGATGTGATTAAACTTCACGATGTAAAGGCTCTCGAATGTCTCACTATCAAGTGCCGTAAGTTAGATAATCCGAACGAATTTGAGCTTGACTTCATCTTTGATCCTGAAAGGAATCTTCATTTCAAAAATCTAGTCCTTACTAAAACATTTTACGGCGAAATGGAGAGGACAATCGGGACAGAGATCAAGTGGTGGAAACCACTCGACAAATGCTACTTGACACGAAAAATTGATAAACTACTATACGAAGGTGCGATTCCACGAGATTATGCAATTGGCTTAACAATTCGAGACAAAATTATTCCTCATGCCATATCATGGTACAATGGGGATGAATATGAAGATGGCAAGAATGTGCTTAAGTTCATTTGA

Protein Analysis

134

Amino Acids

15.82

Weight (kDa)

6.51

Isoelectric Point (pI)

18.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAP PF00956 2 - 81 3.9e-11 Nucleosome assembly protein (NAP)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018576)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 348
AclWI GGATC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 353
AfiI CCNNNNNNNGG 1 cut(s) 348
AflII CTTAAG 1 cut(s) 389
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
Alw26I GTCTC 2 cut(s) 74, 315
AlwI GGATC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 107
ArsI GACNNNNNNTTYG 4 cut(s) 110, 142, 147, 179
BauI CACGAG 1 cut(s) 291
BccI CCATC 1 cut(s) 368
BceAI ACGGC 2 cut(s) 69, 199
BcoDI GTCTC 2 cut(s) 74, 315
BfaI CTAG 1 cut(s) 161
BfrI CTTAAG 1 cut(s) 389
BmsI GCATC 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 348
Bse3DI GCAATG 1 cut(s) 12
BseGI GGATG 1 cut(s) 367
BseLI CCNNNNNNNGG 1 cut(s) 348
BseMI GCAATG 1 cut(s) 12
BslFI GGGAC 1 cut(s) 220
BslI CCNNNNNNNGG 1 cut(s) 348
BsmAI GTCTC 2 cut(s) 74, 315
BsmFI GGGAC 1 cut(s) 220
Bsp143I GATC 2 cut(s) 130, 213
BspPI GGATC 1 cut(s) 125
BspTI CTTAAG 1 cut(s) 389
BsrDI GCAATG 1 cut(s) 12
BssMI GATC 2 cut(s) 130, 213
BssSI CACGAG 1 cut(s) 291
Bst2BI CACGAG 1 cut(s) 291
BstAFI CTTAAG 1 cut(s) 389
BstF5I GGATG 1 cut(s) 367
BstKTI GATC 2 cut(s) 133, 216
BstMAI GTCTC 2 cut(s) 74, 315
BstMBI GATC 2 cut(s) 130, 213
BtsCI GGATG 1 cut(s) 367
Csp6I GTAC 1 cut(s) 352
CviAII CATG 2 cut(s) 338, 348
CviJI RGCY 3 cut(s) 59, 115, 309
CviKI_1 RGCY 3 cut(s) 59, 115, 309
CviQI GTAC 1 cut(s) 352
DpnI GATC 2 cut(s) 132, 215
DpnII GATC 2 cut(s) 130, 213
EcoT22I ATGCAT 1 cut(s) 15
FaeI CATG 2 cut(s) 341, 351
FaiI YATR 7 cut(s) 23, 274, 300, 339, 344, 349, 369
FaqI GGGAC 1 cut(s) 220
FatI CATG 2 cut(s) 337, 347
FokI GGATG 1 cut(s) 374
FspBI CTAG 1 cut(s) 161
Hin1II CATG 2 cut(s) 341, 351
HinfI GANTC 2 cut(s) 142, 286
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 5 cut(s) 47, 62, 134, 205, 320
HpyAV CCTTC 1 cut(s) 272
HpyCH4V TGCA 2 cut(s) 13, 302
Hsp92II CATG 2 cut(s) 341, 351
Kzo9I GATC 2 cut(s) 130, 213
LpnPI CCDG 1 cut(s) 147
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 161
MalI GATC 2 cut(s) 132, 215
MboI GATC 2 cut(s) 130, 213
MboII GAAGA 2 cut(s) 137, 383
MfeI CAATTG 1 cut(s) 303
MluCI AATT 5 cut(s) 107, 258, 303, 315, 327
MnlI CCTC 2 cut(s) 189, 345
Mph1103I ATGCAT 1 cut(s) 15
MseI TTAA 3 cut(s) 39, 311, 390
MspCI CTTAAG 1 cut(s) 389
MunI CAATTG 1 cut(s) 303
NdeII GATC 2 cut(s) 130, 213
NlaIII CATG 2 cut(s) 341, 351
NsiI ATGCAT 1 cut(s) 15
PfeI GAWTC 2 cut(s) 142, 286
PflMI CCANNNNNTGG 1 cut(s) 348
RsaI GTAC 1 cut(s) 353
RsaNI GTAC 1 cut(s) 352
SaqAI TTAA 3 cut(s) 39, 311, 390
Sau3AI GATC 2 cut(s) 130, 213
SetI ASST 2 cut(s) 117, 283
SfaNI GCATC 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 389
SmoI CTYRAG 1 cut(s) 389
Sse9I AATT 5 cut(s) 107, 258, 303, 315, 327
SspMI CTAG 1 cut(s) 161
TaqI TCGA 3 cut(s) 63, 234, 319
TasI AATT 5 cut(s) 107, 258, 303, 315, 327
TfiI GAWTC 2 cut(s) 142, 286
Tru1I TTAA 3 cut(s) 39, 311, 390
Tru9I TTAA 3 cut(s) 39, 311, 390
TspDTI ATGAA 5 cut(s) 112, 137, 378, 384, 385
Van91I CCANNNNNTGG 1 cut(s) 348
Vha464I CTTAAG 1 cut(s) 389
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 161
Zsp2I ATGCAT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.