RLG00000022841

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
13166283 .. 13166729
447 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022841

Sequence Viewer

Length: 333 bp
ATGCCTTACAAACAGTACTACACCATCCCCAGGGCAGACCATGTCAGTTGCTCAGAATATTTTGAGTACAAGGTAATATTGCTGATGCAGAAGAAATTGGAGATTGTTATAATGAACTCCTTGCTGATCTCTCTCCCTAATGGGTATGGGGATGGGGATAGAGATGAGGATGTGAATGTTGGTGAGGATGGCTATGTGCATGGGGATGAGGATTGGAGGAAGCTAGGCCTAAACATTCATTTCCAGTTGTTTCTTCAGATTCTCATCAGGGTTTATGTGTTCAATGATGGAGATGGTGCTAATATTCCACTATTTAAGGTTGGAGGTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.66

Weight (kDa)

4.84

Isoelectric Point (pI)

28.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020520)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0491441
rosa_laevigata RLG00000022841
rosa_multiflora Rmu_sc0006034.1_g000004
rosa_rugosa Rorug03G0249400
rosa_samantha Rh3AG298600 Rh3DG333100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 110, 331
AcuI CTGAAG 1 cut(s) 239
AfaI GTAC 2 cut(s) 17, 68
AfiI CCNNNNNNNGG 1 cut(s) 30
AgsI TTSAA 1 cut(s) 283
AjnI CCWGG 1 cut(s) 29
AluBI AGCT 1 cut(s) 223
AluI AGCT 1 cut(s) 223
AoxI GGCC 1 cut(s) 226
AsuHPI GGTGA 1 cut(s) 194
BccI CCATC 5 cut(s) 32, 146, 182, 281, 287
BciT130I CCWGG 1 cut(s) 31
BfaI CTAG 1 cut(s) 224
BmcAI AGTACT 1 cut(s) 17
Bme1390I CCNGG 1 cut(s) 31
BmrFI CCNGG 1 cut(s) 31
BmsI GCATC 1 cut(s) 75
BsaBI GATNNNNATC 1 cut(s) 263
BsaJI CCNNGG 2 cut(s) 29, 30
Bsc4I CCNNNNNNNGG 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 244
Bse8I GATNNNNATC 1 cut(s) 263
BseBI CCWGG 1 cut(s) 31
BseDI CCNNGG 2 cut(s) 29, 30
BseGI GGATG 5 cut(s) 24, 157, 175, 193, 211
BseJI GATNNNNATC 1 cut(s) 263
BseLI CCNNNNNNNGG 1 cut(s) 30
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 244
BshFI GGCC 1 cut(s) 228
BslI CCNNNNNNNGG 1 cut(s) 30
BsnI GGCC 1 cut(s) 228
Bsp143I GATC 1 cut(s) 126
BspANI GGCC 1 cut(s) 228
BspCNI CTCAG 1 cut(s) 65
BsrI ACTGG 1 cut(s) 244
BssECI CCNNGG 2 cut(s) 29, 30
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 31
Bst4CI ACNGT 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 52
BstF5I GGATG 5 cut(s) 24, 157, 175, 193, 211
BstKTI GATC 1 cut(s) 129
BstMBI GATC 1 cut(s) 126
BstNI CCWGG 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 29
BsuRI GGCC 1 cut(s) 228
BtsCI GGATG 5 cut(s) 24, 157, 175, 193, 211
Csp6I GTAC 2 cut(s) 16, 67
CviAII CATG 2 cut(s) 41, 200
CviJI RGCY 3 cut(s) 192, 223, 228
CviKI_1 RGCY 3 cut(s) 192, 223, 228
CviQI GTAC 2 cut(s) 16, 67
DdeI CTNAG 1 cut(s) 52
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eco147I AGGCCT 1 cut(s) 228
Eco57I CTGAAG 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 29
FaeI CATG 2 cut(s) 44, 203
FaiI YATR 7 cut(s) 42, 110, 147, 195, 201, 276, 331
FatI CATG 2 cut(s) 40, 199
FokI GGATG 5 cut(s) 11, 164, 182, 200, 218
FspBI CTAG 1 cut(s) 224
HaeIII GGCC 1 cut(s) 228
Hin1II CATG 2 cut(s) 44, 203
HinfI GANTC 1 cut(s) 259
HphI GGTGA 1 cut(s) 194
Hpy188I TCNGA 2 cut(s) 55, 258
HpyCH4III ACNGT 1 cut(s) 15
HpyCH4V TGCA 2 cut(s) 88, 199
HpyF3I CTNAG 1 cut(s) 52
Hsp92II CATG 2 cut(s) 44, 203
Kzo9I GATC 1 cut(s) 126
LpnPI CCDG 4 cut(s) 16, 43, 253, 257
LweI GCATC 1 cut(s) 75
MaeI CTAG 1 cut(s) 224
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 2 cut(s) 103, 245
MluCI AATT 1 cut(s) 95
MmeI TCCRAC 1 cut(s) 301
MnlI CCTC 5 cut(s) 160, 178, 202, 210, 317
MseI TTAA 1 cut(s) 315
MslI CAYNNNNRTG 1 cut(s) 204
MspR9I CCNGG 1 cut(s) 31
MvaI CCWGG 1 cut(s) 31
NdeII GATC 1 cut(s) 126
NlaIII CATG 2 cut(s) 44, 203
PasI CCCWGGG 1 cut(s) 30
PceI AGGCCT 1 cut(s) 228
PfeI GAWTC 1 cut(s) 259
PflFI GACNNNGTC 1 cut(s) 41
PsiI TTATAA 2 cut(s) 110, 331
Psp6I CCWGG 1 cut(s) 29
PspGI CCWGG 1 cut(s) 29
PsyI GACNNNGTC 1 cut(s) 41
RsaI GTAC 2 cut(s) 17, 68
RsaNI GTAC 2 cut(s) 16, 67
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 1 cut(s) 315
Sau3AI GATC 1 cut(s) 126
ScaI AGTACT 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 31
SetI ASST 4 cut(s) 75, 225, 321, 328
SfaNI GCATC 1 cut(s) 75
SgeI CNNG 9 cut(s) 42, 43, 53, 82, 133, 212, 236, 256, 280
SmiMI CAYNNNNRTG 1 cut(s) 204
Sse9I AATT 1 cut(s) 95
SseBI AGGCCT 1 cut(s) 228
SspI AATATT 3 cut(s) 59, 78, 304
SspMI CTAG 1 cut(s) 224
StuI AGGCCT 1 cut(s) 228
StyD4I CCNGG 1 cut(s) 29
TaaI ACNGT 1 cut(s) 15
TasI AATT 1 cut(s) 95
TatI WGTACW 2 cut(s) 15, 66
TfiI GAWTC 1 cut(s) 259
Tru1I TTAA 1 cut(s) 315
Tru9I TTAA 1 cut(s) 315
TspDTI ATGAA 2 cut(s) 128, 227
Tth111I GACNNNGTC 1 cut(s) 41
XspI CTAG 1 cut(s) 224
ZrmI AGTACT 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.