Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006034.1

Orthogroup ID

OG0020520

Physical Location & Seq

Genomic Coordinates Reverse (-)

27290 .. 28246

Gene Structure 957 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006034.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 717 bp

atgaactttgtaggcttcttcagtgctttgtatagggatgccaacacatcaagtgtaaaccttgtacttacattatctgctcaagatactgtacgactttgtagagcgggggatgctggtggaattggggatgagggtggccataatgaacttgatgagattgagggtgatgggagtgagagtgaggaagaagaagttgaaggagaaaagcaagaagaggatattgatgatgttgaaggtgagcacggtcgtgtggttcctgtacgttggcttattagaaatgaagatgtgtatgaagctctgattattgaccatgtgcgtccagatgattatgctggtgccttccaattttatcagatgatcctacagattatggaggagaatatacataaaaatgagatagtgcattacaaaatcaatgccttacaactgtactgcaccatccccagggcagaccagttgctccgaatatttgagtacaagtgctggatactcaactctccaaatcctctgccacaagggtataaagttttttatgtcacagctgtccctaatggggatggagatgaggatggctatgtgcatggggatgaggattcgagggagctaggcctaaacattcaattccagttgtttcttcaaattctcatcagggtctatgtgttcgatgatggagatggtgctaatataccactatttcaggttggaggtctatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

238

Amino Acids

26.89

Weight (kDa)

4.22

Isoelectric Point (pI)

54.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020520)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0491441
rosa_laevigata	RLG00000022841
rosa_multiflora	Rmu_sc0006034.1_g000004
rosa_rugosa	Rorug03G0249400
rosa_samantha	Rh3AG298600 Rh3DG333100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	338
AccBSI	CCGCTC	1 cut(s)	107
AciI	CCGC	1 cut(s)	107
AclWI	GGATC	1 cut(s)	355
AcoI	YGGCCR	1 cut(s)	139
AcsI	RAATTY	1 cut(s)	642
AcuI	CTGAAG	1 cut(s)	4
AfaI	GTAC	5 cut(s)	66, 93, 264, 434, 479
AfiI	CCNNNNNNNGG	2 cut(s)	447, 556
AgsI	TTSAA	4 cut(s)	200, 236, 623, 641
AjnI	CCWGG	1 cut(s)	446
AleI	CACNNNNGTG	1 cut(s)	249
AluBI	AGCT	3 cut(s)	299, 545, 607
AluI	AGCT	3 cut(s)	299, 545, 607
Alw21I	GWGCWC	1 cut(s)	246
AlwI	GGATC	1 cut(s)	355
AoxI	GGCC	2 cut(s)	139, 610
ApoI	RAATTY	1 cut(s)	642
AsuHPI	GGTGA	2 cut(s)	179, 251
BalI	TGGCCA	1 cut(s)	141
BanI	GGYRCC	1 cut(s)	338
Bbv12I	GWGCWC	1 cut(s)	246
BccI	CCATC	6 cut(s)	164, 449, 554, 566, 665, 671
BciT130I	CCWGG	1 cut(s)	448
BciVI	GTATCC	1 cut(s)	483
BfaI	CTAG	1 cut(s)	608
BfmI	CTRYAG	2 cut(s)	365, 713
BfuI	GTATCC	1 cut(s)	483
Bme1390I	CCNGG	1 cut(s)	448
BmiI	GGNNCC	2 cut(s)	258, 340
BmrFI	CCNGG	1 cut(s)	448
BmsI	GCATC	2 cut(s)	28, 103
BpuEI	CTTGAG	1 cut(s)	66
BsaJI	CCNNGG	2 cut(s)	446, 447
BsaXI	ACNNNNNCTCC	2 cut(s)	166, 196
Bsc4I	CCNNNNNNNGG	2 cut(s)	447, 556
Bse1I	ACTGG	2 cut(s)	457, 628
BseBI	CCWGG	1 cut(s)	448
BseDI	CCNNGG	2 cut(s)	446, 447
BseGI	GGATG	7 cut(s)	43, 118, 136, 441, 565, 577, 595
BseLI	CCNNNNNNNGG	2 cut(s)	447, 556
BseNI	ACTGG	2 cut(s)	457, 628
BseRI	GAGGAG	1 cut(s)	392
BsgI	GTGCAG	1 cut(s)	421
Bsh1285I	CGRYCG	1 cut(s)	250
BshFI	GGCC	2 cut(s)	141, 612
BshNI	GGYRCC	1 cut(s)	338
BsiEI	CGRYCG	1 cut(s)	250
BsiHKAI	GWGCWC	1 cut(s)	246
BslFI	GGGAC	1 cut(s)	533
BslI	CCNNNNNNNGG	2 cut(s)	447, 556
BsmFI	GGGAC	1 cut(s)	533
BsnI	GGCC	2 cut(s)	141, 612
Bsp1286I	GDGCHC	1 cut(s)	246
Bsp143I	GATC	1 cut(s)	360
BspACI	CCGC	1 cut(s)	107
BspANI	GGCC	2 cut(s)	141, 612
BspLI	GGNNCC	2 cut(s)	258, 340
BspPI	GGATC	1 cut(s)	355
BspT107I	GGYRCC	1 cut(s)	338
BsrBI	CCGCTC	1 cut(s)	107
BsrI	ACTGG	2 cut(s)	457, 628
BssECI	CCNNGG	2 cut(s)	446, 447
BssMI	GATC	1 cut(s)	360
Bst2UI	CCWGG	1 cut(s)	448
Bst4CI	ACNGT	3 cut(s)	91, 248, 432
Bst6I	CTCTTC	1 cut(s)	210
BstF5I	GGATG	7 cut(s)	43, 118, 136, 441, 565, 577, 595
BstKTI	GATC	1 cut(s)	363
BstMBI	GATC	1 cut(s)	360
BstMCI	CGRYCG	1 cut(s)	250
BstMWI	GCNNNNNNNGC	1 cut(s)	113
BstNI	CCWGG	1 cut(s)	448
BstSCI	CCNGG	1 cut(s)	446
BstSFI	CTRYAG	2 cut(s)	365, 713
BsuI	GTATCC	1 cut(s)	483
BsuRI	GGCC	2 cut(s)	141, 612
BtsCI	GGATG	7 cut(s)	43, 118, 136, 441, 565, 577, 595
BtsIMutI	CAGTG	1 cut(s)	28
CseI	GACGC	1 cut(s)	308
Csp6I	GTAC	5 cut(s)	65, 92, 263, 433, 478
CviAII	CATG	2 cut(s)	314, 584
CviJI	RGCY	8 cut(s)	15, 141, 271, 299, 545, 576, 607, 612
CviKI_1	RGCY	8 cut(s)	15, 141, 271, 299, 545, 576, 607, 612
CviQI	GTAC	5 cut(s)	65, 92, 263, 433, 478
DpnI	GATC	1 cut(s)	362
DpnII	GATC	1 cut(s)	360
EaeI	YGGCCR	1 cut(s)	139
Eam1104I	CTCTTC	1 cut(s)	210
EarI	CTCTTC	1 cut(s)	210
Eco147I	AGGCCT	1 cut(s)	612
Eco57I	CTGAAG	1 cut(s)	4
EcoRII	CCWGG	1 cut(s)	446
FaeI	CATG	2 cut(s)	317, 587
FaqI	GGGAC	1 cut(s)	533
FatI	CATG	2 cut(s)	313, 583
FauI	CCCGC	1 cut(s)	100
FokI	GGATG	7 cut(s)	50, 125, 143, 428, 572, 584, 602
FspBI	CTAG	1 cut(s)	608
HaeIII	GGCC	2 cut(s)	141, 612
HgaI	GACGC	1 cut(s)	308
Hin1II	CATG	2 cut(s)	317, 587
HinfI	GANTC	1 cut(s)	596
HphI	GGTGA	2 cut(s)	179, 251
Hpy166II	GTNNAC	1 cut(s)	58
Hpy188I	TCNGA	3 cut(s)	303, 357, 467
Hpy188III	TCNNGA	2 cut(s)	83, 323
Hpy8I	GTNNAC	1 cut(s)	58
HpyAV	CCTTC	3 cut(s)	194, 230, 352
HpyCH4III	ACNGT	3 cut(s)	91, 248, 432
HpyCH4IV	ACGT	1 cut(s)	265
HpyCH4V	TGCA	3 cut(s)	406, 438, 583
HpyF10VI	GCNNNNNNNGC	1 cut(s)	113
HpySE526I	ACGT	1 cut(s)	265
Hsp92II	CATG	2 cut(s)	317, 587
Kzo9I	GATC	1 cut(s)	360
LmnI	GCTCC	2 cut(s)	468, 604
LweI	GCATC	2 cut(s)	28, 103
MaeI	CTAG	1 cut(s)	608
MaeII	ACGT	1 cut(s)	265
MaeIII	GTNAC	1 cut(s)	538
MalI	GATC	1 cut(s)	362
MbiI	CCGCTC	1 cut(s)	107
MboI	GATC	1 cut(s)	360
MboII	GAAGA	6 cut(s)	10, 200, 203, 227, 296, 629
MhlI	GDGCHC	1 cut(s)	246
MlsI	TGGCCA	1 cut(s)	141
MluCI	AATT	4 cut(s)	123, 347, 623, 642
MluNI	TGGCCA	1 cut(s)	141
MmeI	TCCRAC	1 cut(s)	685
Mox20I	TGGCCA	1 cut(s)	141
MscI	TGGCCA	1 cut(s)	141
MslI	CAYNNNNRTG	3 cut(s)	249, 393, 588
Msp20I	TGGCCA	1 cut(s)	141
MspA1I	CMGCKG	1 cut(s)	545
MspR9I	CCNGG	1 cut(s)	448
MvaI	CCWGG	1 cut(s)	448
MwoI	GCNNNNNNNGC	1 cut(s)	113
NdeII	GATC	1 cut(s)	360
NlaIII	CATG	2 cut(s)	317, 587
NlaIV	GGNNCC	2 cut(s)	258, 340
NmuCI	GTSAC	1 cut(s)	538
OliI	CACNNNNGTG	1 cut(s)	249
PasI	CCCWGGG	1 cut(s)	447
PceI	AGGCCT	1 cut(s)	612
PfeI	GAWTC	1 cut(s)	596
Psp6I	CCWGG	1 cut(s)	446
PspGI	CCWGG	1 cut(s)	446
PspN4I	GGNNCC	2 cut(s)	258, 340
PvuII	CAGCTG	1 cut(s)	545
RsaI	GTAC	5 cut(s)	66, 93, 264, 434, 479
RsaNI	GTAC	5 cut(s)	65, 92, 263, 433, 478
RseI	CAYNNNNRTG	3 cut(s)	249, 393, 588
Sau3AI	GATC	1 cut(s)	360
ScrFI	CCNGG	1 cut(s)	448
SduI	GDGCHC	1 cut(s)	246
SetI	ASST	8 cut(s)	63, 241, 268, 301, 547, 609, 705, 712
SfaNI	GCATC	2 cut(s)	28, 103
SfcI	CTRYAG	2 cut(s)	365, 713
SmiMI	CAYNNNNRTG	3 cut(s)	249, 393, 588
SmlI	CTYRAG	1 cut(s)	81
SmoI	CTYRAG	1 cut(s)	81
Sse9I	AATT	4 cut(s)	123, 347, 623, 642
SseBI	AGGCCT	1 cut(s)	612
SsiI	CCGC	1 cut(s)	107
SspI	AATATT	1 cut(s)	471
SspMI	CTAG	1 cut(s)	608
StuI	AGGCCT	1 cut(s)	612
StyD4I	CCNGG	1 cut(s)	446
TaaI	ACNGT	3 cut(s)	91, 248, 432
TaiI	ACGT	1 cut(s)	268
TaqI	TCGA	2 cut(s)	599, 666
TasI	AATT	4 cut(s)	123, 347, 623, 642
TatI	WGTACW	3 cut(s)	64, 432, 477
TfiI	GAWTC	1 cut(s)	596
TscAI	CASTG	1 cut(s)	28
TseFI	GTSAC	1 cut(s)	538
Tsp45I	GTSAC	1 cut(s)	538
TspDTI	ATGAA	4 cut(s)	17, 162, 297, 309
TspRI	CASTG	1 cut(s)	28
XapI	RAATTY	1 cut(s)	642
XspI	CTAG	1 cut(s)	608

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.