RLG00000034513

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0007429
Physical Location & Seq
Reverse (-)
44045869 .. 44046579
711 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034513

Sequence Viewer

Length: 552 bp
ATGGCGGCAGATCTGGTATTAGACACCACGATCAGAGACTGGGTCCTGGCGATCAGCACCACCACCACCACCCGCTGTTCCACCACCTTCGCAGCATGTCGCAGCTCCTCCACCAAGCCTCGGCCTCCTTCGCCTCTAACCTCCTCACCTTCCTCTTCCTCTCCCTCCTCATCTTCTCCTTCCGCACCGTCGTCAAGAATGGGACCCACCTCCTTACCGTCGTCGAGAATGGGACCCACCTCCTCACCCTTCCCTCAAGTCCCTCCTATCCCGCCTCGACCTTGCCGCCAACCCCAACTCGTGATCCCTCGACGAGGACTTCTTCTCCGCCAACCCCAACTCTCTAAAACCCCTCTCCAAATCAAACCCACCACCACTCTGTTTCAGGTTTGCATGGCCGTAAACCTTCATTGCTTAGATTTGTTAATTGGCTTCGAGTTGAGTTGCTTTGGATCTGACAGATCTAGATGTAGGAACTCTCACAAACATGCAATTGTTGAGAGGGCCATGTATGTTTCTTCTTATGGCATTGTTATCCTTAAAAAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR TIR_2

Protein Analysis

184

Amino Acids

19.84

Weight (kDa)

10.48

Isoelectric Point (pI)

78.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 5, 73, 183, 272, 286, 328
AclWI GGATC 2 cut(s) 298, 460
AcoI YGGCCR 1 cut(s) 396
AfiI CCNNNNNNNGG 2 cut(s) 120, 314
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw26I GTCTC 1 cut(s) 30
AlwI GGATC 2 cut(s) 298, 460
AlwNI CAGNNNCTG 1 cut(s) 39
AoxI GGCC 3 cut(s) 122, 396, 504
ApeKI GCWGC 2 cut(s) 92, 102
AspS9I GGNCC 4 cut(s) 43, 203, 233, 504
AsuHPI GGTGA 2 cut(s) 138, 237
AvaII GGWCC 3 cut(s) 43, 203, 233
BauI CACGAG 1 cut(s) 299
BbvI GCAGC 2 cut(s) 104, 114
BceAI ACGGC 1 cut(s) 383
BciT130I CCWGG 1 cut(s) 47
BcoDI GTCTC 1 cut(s) 30
BfaI CTAG 1 cut(s) 465
BglII AGATCT 2 cut(s) 10, 461
BisI GCNGC 4 cut(s) 6, 93, 103, 286
BlsI GCNGC 4 cut(s) 7, 94, 104, 287
Bme1390I CCNGG 1 cut(s) 47
Bme18I GGWCC 3 cut(s) 43, 203, 233
BmgT120I GGNCC 4 cut(s) 43, 203, 233, 504
BmiI GGNNCC 5 cut(s) 44, 204, 205, 234, 235
BmrFI CCNGG 1 cut(s) 47
BmrI ACTGGG 1 cut(s) 49
BmuI ACTGGG 1 cut(s) 49
BpuEI CTTGAG 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 119
BsaXI ACNNNNNCTCC 2 cut(s) 309, 339
Bsc4I CCNNNNNNNGG 2 cut(s) 120, 314
Bse1I ACTGG 1 cut(s) 44
Bse3DI GCAATG 1 cut(s) 409
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 119
BseLI CCNNNNNNNGG 2 cut(s) 120, 314
BseMI GCAATG 1 cut(s) 409
BseNI ACTGG 1 cut(s) 44
BseRI GAGGAG 4 cut(s) 97, 133, 157, 232
BseXI GCAGC 2 cut(s) 104, 114
BshFI GGCC 3 cut(s) 124, 398, 506
BslFI GGGAC 3 cut(s) 216, 245, 246
BslI CCNNNNNNNGG 2 cut(s) 120, 314
BsmAI GTCTC 1 cut(s) 30
BsmFI GGGAC 3 cut(s) 216, 245, 246
BsnI GGCC 3 cut(s) 124, 398, 506
Bsp143I GATC 6 cut(s) 10, 30, 51, 303, 452, 461
BspACI CCGC 6 cut(s) 5, 73, 183, 272, 286, 328
BspANI GGCC 3 cut(s) 124, 398, 506
BspLI GGNNCC 5 cut(s) 44, 204, 205, 234, 235
BspPI GGATC 2 cut(s) 298, 460
BsrDI GCAATG 1 cut(s) 409
BsrI ACTGG 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 6 cut(s) 10, 30, 51, 303, 452, 461
BssSI CACGAG 1 cut(s) 299
Bst2BI CACGAG 1 cut(s) 299
Bst2UI CCWGG 1 cut(s) 47
Bst4CI ACNGT 2 cut(s) 189, 219
Bst6I CTCTTC 1 cut(s) 160
BstDEI CTNAG 1 cut(s) 415
BstENI CCTNNNNNAGG 1 cut(s) 312
BstKTI GATC 6 cut(s) 13, 33, 54, 306, 455, 464
BstMAI GTCTC 1 cut(s) 30
BstMBI GATC 6 cut(s) 10, 30, 51, 303, 452, 461
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 2 cut(s) 99, 491
BstSCI CCNGG 1 cut(s) 45
BstV1I GCAGC 2 cut(s) 104, 114
BstX2I RGATCY 3 cut(s) 10, 452, 461
BstYI RGATCY 3 cut(s) 10, 452, 461
BsuRI GGCC 3 cut(s) 124, 398, 506
CaiI CAGNNNCTG 1 cut(s) 39
Cfr13I GGNCC 4 cut(s) 43, 203, 233, 504
CviAII CATG 4 cut(s) 96, 394, 488, 508
CviJI RGCY 6 cut(s) 105, 118, 124, 398, 432, 506
CviKI_1 RGCY 6 cut(s) 105, 118, 124, 398, 432, 506
DdeI CTNAG 1 cut(s) 415
DpnI GATC 6 cut(s) 12, 32, 53, 305, 454, 463
DpnII GATC 6 cut(s) 10, 30, 51, 303, 452, 461
EaeI YGGCCR 1 cut(s) 396
Eam1104I CTCTTC 1 cut(s) 160
EarI CTCTTC 1 cut(s) 160
EciI GGCGGA 1 cut(s) 317
Eco47I GGWCC 3 cut(s) 43, 203, 233
EcoNI CCTNNNNNAGG 1 cut(s) 312
EcoO109I RGGNCCY 3 cut(s) 43, 203, 233
EcoRII CCWGG 1 cut(s) 45
FaeI CATG 4 cut(s) 99, 397, 491, 511
FaiI YATR 6 cut(s) 97, 395, 489, 509, 513, 525
FaqI GGGAC 3 cut(s) 216, 245, 246
FatI CATG 4 cut(s) 95, 393, 487, 507
FauI CCCGC 2 cut(s) 80, 279
Fnu4HI GCNGC 4 cut(s) 6, 93, 103, 286
Fsp4HI GCNGC 4 cut(s) 6, 93, 103, 286
FspBI CTAG 1 cut(s) 465
GluI GCNGC 4 cut(s) 6, 93, 103, 286
HaeIII GGCC 3 cut(s) 124, 398, 506
Hin1II CATG 4 cut(s) 99, 397, 491, 511
HphI GGTGA 2 cut(s) 138, 237
Hpy166II GTNNAC 1 cut(s) 403
Hpy188I TCNGA 2 cut(s) 35, 457
Hpy188III TCNNGA 4 cut(s) 195, 225, 301, 465
Hpy8I GTNNAC 1 cut(s) 403
Hpy99I CGWCG 4 cut(s) 193, 223, 226, 315
HpyAV CCTTC 6 cut(s) 97, 138, 159, 189, 259, 416
HpyCH4III ACNGT 2 cut(s) 189, 219
HpyCH4V TGCA 2 cut(s) 393, 491
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 415
Hsp92II CATG 4 cut(s) 99, 397, 491, 511
KflI GGGWCCC 2 cut(s) 203, 233
Kzo9I GATC 6 cut(s) 10, 30, 51, 303, 452, 461
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 4 cut(s) 25, 32, 59, 371
Lsp1109I GCAGC 2 cut(s) 104, 114
MaeI CTAG 1 cut(s) 465
MalI GATC 6 cut(s) 12, 32, 53, 305, 454, 463
MboI GATC 6 cut(s) 10, 30, 51, 303, 452, 461
MboII GAAGA 4 cut(s) 147, 165, 314, 510
MfeI CAATTG 1 cut(s) 492
MflI RGATCY 3 cut(s) 10, 452, 461
MluCI AATT 2 cut(s) 426, 492
MseI TTAA 2 cut(s) 425, 540
MslI CAYNNNNRTG 1 cut(s) 486
MspA1I CMGCKG 1 cut(s) 75
MspR9I CCNGG 1 cut(s) 47
MunI CAATTG 1 cut(s) 492
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 130
NdeII GATC 6 cut(s) 10, 30, 51, 303, 452, 461
NlaIII CATG 4 cut(s) 99, 397, 491, 511
NlaIV GGNNCC 5 cut(s) 44, 204, 205, 234, 235
NmeAIII GCCGAG 1 cut(s) 100
NspI RCATGY 2 cut(s) 99, 491
PflFI GACNNNGTC 1 cut(s) 41
PkrI GCNGC 4 cut(s) 7, 94, 104, 287
PpuMI RGGWCCY 3 cut(s) 43, 203, 233
Psp5II RGGWCCY 3 cut(s) 43, 203, 233
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PspN4I GGNNCC 5 cut(s) 44, 204, 205, 234, 235
PspPI GGNCC 4 cut(s) 43, 203, 233, 504
PspPPI RGGWCCY 3 cut(s) 43, 203, 233
PstNI CAGNNNCTG 1 cut(s) 39
PsuI RGATCY 3 cut(s) 10, 452, 461
PsyI GACNNNGTC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 486
SaqAI TTAA 2 cut(s) 425, 540
SatI GCNGC 4 cut(s) 6, 93, 103, 286
Sau3AI GATC 6 cut(s) 10, 30, 51, 303, 452, 461
Sau96I GGNCC 4 cut(s) 43, 203, 233, 504
ScrFI CCNGG 1 cut(s) 47
SetI ASST 9 cut(s) 89, 107, 143, 151, 212, 242, 283, 390, 408
SinI GGWCC 3 cut(s) 43, 203, 233
SmiMI CAYNNNNRTG 1 cut(s) 486
SmlI CTYRAG 1 cut(s) 255
SmoI CTYRAG 1 cut(s) 255
Sse9I AATT 2 cut(s) 426, 492
SsiI CCGC 6 cut(s) 5, 73, 183, 272, 286, 328
SspMI CTAG 1 cut(s) 465
StyD4I CCNGG 1 cut(s) 45
TaaI ACNGT 2 cut(s) 189, 219
TaqI TCGA 4 cut(s) 224, 277, 310, 435
TasI AATT 2 cut(s) 426, 492
TauI GCSGC 2 cut(s) 8, 288
Tru1I TTAA 2 cut(s) 425, 540
Tru9I TTAA 2 cut(s) 425, 540
TseI GCWGC 2 cut(s) 92, 102
TspDTI ATGAA 1 cut(s) 398
Tth111I GACNNNGTC 1 cut(s) 41
VpaK11BI GGWCC 3 cut(s) 43, 203, 233
XagI CCTNNNNNAGG 1 cut(s) 312
XbaI TCTAGA 1 cut(s) 464
XceI RCATGY 2 cut(s) 99, 491
XspI CTAG 1 cut(s) 465
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.