Rmu_co8005752.1_g000001

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8005752.1
Physical Location & Seq
Reverse (-)
2 .. 395
394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8005752.1_g000001.1.cds

Sequence Viewer

Length: 291 bp
atgaagtaccatgtgactgttctagctggagaccatgataagaaagaaatggtgaaactcgaagttgatggaggaggagactcggctttggtagaggctagattctctgatggggtgtatgataagcctctatcatgctttggttgtggcattggatggttctccagatttctattgggatttgcttttcctccactctggtactatgcaacagtgctttactttgggaattatcttaaagaccctagagagagacccggccttgcagcatctgcaattgcagtaagaatg

Protein Analysis

97

Amino Acids

10.8

Weight (kDa)

6.71

Isoelectric Point (pI)

26.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016357)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 8, 203
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
Alw26I GTCTC 3 cut(s) 24, 72, 247
AlwNI CAGNNNCTG 1 cut(s) 272
AoxI GGCC 1 cut(s) 259
ApeKI GCWGC 1 cut(s) 266
AsuC2I CCSGG 1 cut(s) 258
AsuHPI GGTGA 1 cut(s) 64
BbvI GCAGC 1 cut(s) 278
BccI CCATC 3 cut(s) 62, 104, 150
BcnI CCSGG 1 cut(s) 258
BcoDI GTCTC 3 cut(s) 24, 72, 247
BfaI CTAG 3 cut(s) 23, 99, 246
BisI GCNGC 1 cut(s) 267
BlsI GCNGC 1 cut(s) 268
Bme1390I CCNGG 1 cut(s) 258
BmrFI CCNGG 1 cut(s) 258
BmsI GCATC 1 cut(s) 278
BpmI CTGGAG 2 cut(s) 48, 148
BpuMI CCSGG 1 cut(s) 258
BsaI GGTCTC 2 cut(s) 24, 247
BseGI GGATG 1 cut(s) 161
BseRI GAGGAG 2 cut(s) 87, 90
BseXI GCAGC 1 cut(s) 278
BshFI GGCC 1 cut(s) 261
BsiSI CCGG 1 cut(s) 258
BsmAI GTCTC 3 cut(s) 24, 72, 247
BsnI GGCC 1 cut(s) 261
Bso31I GGTCTC 2 cut(s) 24, 247
BspANI GGCC 1 cut(s) 261
BspTNI GGTCTC 2 cut(s) 24, 247
Bst4CI ACNGT 2 cut(s) 19, 214
BstAPI GCANNNNNTGC 1 cut(s) 272
BstF5I GGATG 1 cut(s) 161
BstMAI GTCTC 3 cut(s) 24, 72, 247
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 256
BstV1I GCAGC 1 cut(s) 278
BsuRI GGCC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 161
BtsIMutI CAGTG 1 cut(s) 219
CaiI CAGNNNCTG 1 cut(s) 272
Csp6I GTAC 2 cut(s) 7, 202
CviAII CATG 3 cut(s) 11, 35, 135
CviJI RGCY 5 cut(s) 26, 86, 98, 127, 261
CviKI_1 RGCY 5 cut(s) 26, 86, 98, 127, 261
CviQI GTAC 2 cut(s) 7, 202
Eco31I GGTCTC 2 cut(s) 24, 247
FaeI CATG 3 cut(s) 14, 38, 138
FaiI YATR 5 cut(s) 12, 36, 120, 136, 207
FatI CATG 3 cut(s) 10, 34, 134
Fnu4HI GCNGC 1 cut(s) 267
FokI GGATG 1 cut(s) 168
Fsp4HI GCNGC 1 cut(s) 267
FspBI CTAG 3 cut(s) 23, 99, 246
GluI GCNGC 1 cut(s) 267
GsuI CTGGAG 2 cut(s) 48, 148
HaeIII GGCC 1 cut(s) 261
HapII CCGG 1 cut(s) 258
Hin1II CATG 3 cut(s) 14, 38, 138
HinfI GANTC 2 cut(s) 80, 102
HpaII CCGG 1 cut(s) 258
HphI GGTGA 1 cut(s) 64
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 165
HpyCH4III ACNGT 2 cut(s) 19, 214
HpyCH4V TGCA 4 cut(s) 209, 266, 275, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
Hsp92II CATG 3 cut(s) 14, 38, 138
LpnPI CCDG 4 cut(s) 12, 178, 184, 271
Lsp1109I GCAGC 1 cut(s) 278
LweI GCATC 1 cut(s) 278
MaeI CTAG 3 cut(s) 23, 99, 246
MaeIII GTNAC 1 cut(s) 13
MfeI CAATTG 1 cut(s) 276
MluCI AATT 2 cut(s) 229, 276
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 5 cut(s) 65, 68, 88, 138, 201
MseI TTAA 1 cut(s) 237
MspI CCGG 1 cut(s) 258
MspR9I CCNGG 1 cut(s) 258
MunI CAATTG 1 cut(s) 276
MwoI GCNNNNNNNGC 1 cut(s) 272
NciI CCSGG 1 cut(s) 258
NlaIII CATG 3 cut(s) 14, 38, 138
NmeAIII GCCGAG 1 cut(s) 62
NmuCI GTSAC 1 cut(s) 13
PfeI GAWTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 268
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
PstNI CAGNNNCTG 1 cut(s) 272
RsaI GTAC 2 cut(s) 8, 203
RsaNI GTAC 2 cut(s) 7, 202
SaqAI TTAA 1 cut(s) 237
SatI GCNGC 1 cut(s) 267
SchI GAGTC 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 258
SetI ASST 1 cut(s) 28
SfaNI GCATC 1 cut(s) 278
Sse9I AATT 2 cut(s) 229, 276
SspMI CTAG 3 cut(s) 23, 99, 246
StyD4I CCNGG 1 cut(s) 256
TaaI ACNGT 2 cut(s) 19, 214
TaqI TCGA 1 cut(s) 60
TasI AATT 2 cut(s) 229, 276
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 1 cut(s) 219
TseFI GTSAC 1 cut(s) 13
TseI GCWGC 1 cut(s) 266
Tsp45I GTSAC 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 219
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
XspI CTAG 3 cut(s) 23, 99, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.