Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8045854.1

Orthogroup ID

OG0020522

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 557

Gene Structure 557 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8045854.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 313 bp

tccatgatgcccattgtgtttgcaggctcttgaatggaaacaaactatcgggttccttgcctgatgagctcggttctcttgaaaatctacgtagactacaagttgacgagaaccatctttcagggtcaataccaaaatcatttcttaacttgcgcggcttaaaacacctccatatgaacaacaactccttcagcggccaaattccatctgagatttctgaaatacccgctcttcttcatgtgctcttggataataataacttatctggatatcttccaccagacttctccaacataccagagttgcgcatact

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

104

Amino Acids

11.54

Weight (kDa)

6.03

Isoelectric Point (pI)

38.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020522)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0459961
rosa_multiflora	Rmu_co8045854.1_g000001 Rmu_sc0000240.1_g000050 Rmu_sc0000240.1_g000052 Rmu_sc0000579.1_g000013 Rmu_sc0016534.1_g000003

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	307
AccBSI	CCGCTC	1 cut(s)	229
AccI	GTMKAC	1 cut(s)	93
AccII	CGCG	1 cut(s)	155
AciI	CCGC	3 cut(s)	155, 194, 227
AcoI	YGGCCR	1 cut(s)	195
AcsI	RAATTY	1 cut(s)	200
AcuI	CTGAAG	1 cut(s)	174
AgsI	TTSAA	2 cut(s)	33, 82
AloI	GAACNNNNNNTCC	2 cut(s)	169, 201
AluBI	AGCT	1 cut(s)	69
AluI	AGCT	1 cut(s)	69
Alw21I	GWGCWC	2 cut(s)	71, 245
AoxI	GGCC	1 cut(s)	195
ApoI	RAATTY	1 cut(s)	200
AspLEI	GCGC	2 cut(s)	155, 308
BanII	GRGCYC	1 cut(s)	71
Bbv12I	GWGCWC	2 cut(s)	71, 245
BccI	CCATC	2 cut(s)	122, 213
BisI	GCNGC	2 cut(s)	156, 195
BlsI	GCNGC	2 cut(s)	157, 196
BmiI	GGNNCC	1 cut(s)	54
BsaAI	YACGTR	1 cut(s)	91
BsaXI	ACNNNNNCTCC	2 cut(s)	169, 199
BseMII	CTCAG	1 cut(s)	200
Bsh1236I	CGCG	1 cut(s)	155
BshFI	GGCC	1 cut(s)	197
BsiHKAI	GWGCWC	2 cut(s)	71, 245
BsnI	GGCC	1 cut(s)	197
Bsp1286I	GDGCHC	2 cut(s)	71, 245
BspACI	CCGC	3 cut(s)	155, 194, 227
BspANI	GGCC	1 cut(s)	197
BspCNI	CTCAG	1 cut(s)	201
BspFNI	CGCG	1 cut(s)	155
BspLI	GGNNCC	1 cut(s)	54
BspQI	GCTCTTC	1 cut(s)	236
BsrBI	CCGCTC	1 cut(s)	229
Bst6I	CTCTTC	1 cut(s)	236
BstBAI	YACGTR	1 cut(s)	91
BstC8I	GCNNGC	1 cut(s)	25
BstDEI	CTNAG	1 cut(s)	209
BstFNI	CGCG	1 cut(s)	155
BstHHI	GCGC	2 cut(s)	155, 308
BstMWI	GCNNNNNNNGC	1 cut(s)	66
BstSNI	TACGTA	1 cut(s)	91
BstUI	CGCG	1 cut(s)	155
BsuRI	GGCC	1 cut(s)	197
Cac8I	GCNNGC	1 cut(s)	25
CfoI	GCGC	2 cut(s)	155, 308
CviAII	CATG	2 cut(s)	4, 238
CviJI	RGCY	4 cut(s)	27, 69, 158, 197
CviKI_1	RGCY	4 cut(s)	27, 69, 158, 197
DdeI	CTNAG	1 cut(s)	209
EaeI	YGGCCR	1 cut(s)	195
Eam1104I	CTCTTC	1 cut(s)	236
EarI	CTCTTC	1 cut(s)	236
Ecl136II	GAGCTC	1 cut(s)	69
Eco105I	TACGTA	1 cut(s)	91
Eco24I	GRGCYC	1 cut(s)	71
Eco32I	GATATC	1 cut(s)	271
Eco53kI	GAGCTC	1 cut(s)	69
Eco57I	CTGAAG	1 cut(s)	174
EcoICRI	GAGCTC	1 cut(s)	69
EcoRV	GATATC	1 cut(s)	271
EcoT38I	GRGCYC	1 cut(s)	71
FaeI	CATG	2 cut(s)	7, 241
FaiI	YATR	6 cut(s)	5, 173, 175, 239, 295, 310
FatI	CATG	2 cut(s)	3, 237
FauI	CCCGC	1 cut(s)	234
FauNDI	CATATG	1 cut(s)	173
FblI	GTMKAC	1 cut(s)	93
Fnu4HI	GCNGC	2 cut(s)	156, 195
FriOI	GRGCYC	1 cut(s)	71
Fsp4HI	GCNGC	2 cut(s)	156, 195
FspI	TGCGCA	1 cut(s)	307
GlaI	GCGC	2 cut(s)	154, 307
GluI	GCNGC	2 cut(s)	156, 195
HaeIII	GGCC	1 cut(s)	197
HhaI	GCGC	2 cut(s)	155, 308
Hin1II	CATG	2 cut(s)	7, 241
Hin6I	GCGC	2 cut(s)	153, 306
HinP1I	GCGC	2 cut(s)	153, 306
HincII	GTYRAC	1 cut(s)	105
HindII	GTYRAC	1 cut(s)	105
Hpy166II	GTNNAC	2 cut(s)	94, 105
Hpy188I	TCNGA	2 cut(s)	210, 219
Hpy188III	TCNNGA	3 cut(s)	30, 79, 266
Hpy8I	GTNNAC	2 cut(s)	94, 105
HpyAV	CCTTC	1 cut(s)	198
HpyCH4IV	ACGT	1 cut(s)	90
HpyCH4V	TGCA	1 cut(s)	23
HpyF10VI	GCNNNNNNNGC	1 cut(s)	66
HpyF3I	CTNAG	1 cut(s)	209
HpySE526I	ACGT	1 cut(s)	90
Hsp92II	CATG	2 cut(s)	7, 241
HspAI	GCGC	2 cut(s)	153, 306
LguI	GCTCTTC	1 cut(s)	236
LpnPI	CCDG	5 cut(s)	9, 74, 107, 251, 293
MaeII	ACGT	1 cut(s)	90
MbiI	CCGCTC	1 cut(s)	229
MboII	GAAGA	3 cut(s)	223, 226, 265
MhlI	GDGCHC	2 cut(s)	71, 245
MluCI	AATT	1 cut(s)	200
MnlI	CCTC	1 cut(s)	178
MseI	TTAA	2 cut(s)	146, 160
MspA1I	CMGCKG	1 cut(s)	194
MvnI	CGCG	1 cut(s)	155
MwoI	GCNNNNNNNGC	1 cut(s)	66
NdeI	CATATG	1 cut(s)	173
NlaIII	CATG	2 cut(s)	7, 241
NlaIV	GGNNCC	1 cut(s)	54
NsbI	TGCGCA	1 cut(s)	307
PciSI	GCTCTTC	1 cut(s)	236
PkrI	GCNGC	2 cut(s)	157, 196
Ppu21I	YACGTR	1 cut(s)	91
Psp124BI	GAGCTC	1 cut(s)	71
PspN4I	GGNNCC	1 cut(s)	54
SacI	GAGCTC	1 cut(s)	71
SapI	GCTCTTC	1 cut(s)	236
SaqAI	TTAA	2 cut(s)	146, 160
SatI	GCNGC	2 cut(s)	156, 195
SduI	GDGCHC	2 cut(s)	71, 245
SetI	ASST	3 cut(s)	71, 93, 170
SnaBI	TACGTA	1 cut(s)	91
Sse9I	AATT	1 cut(s)	200
SsiI	CCGC	3 cut(s)	155, 194, 227
SstI	GAGCTC	1 cut(s)	71
TaiI	ACGT	1 cut(s)	93
TasI	AATT	1 cut(s)	200
TauI	GCSGC	2 cut(s)	158, 197
Tru1I	TTAA	2 cut(s)	146, 160
Tru9I	TTAA	2 cut(s)	146, 160
TspDTI	ATGAA	2 cut(s)	190, 226
XapI	RAATTY	1 cut(s)	200
XmiI	GTMKAC	1 cut(s)	93

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.