Rmu_sc0000240.1_g000050
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000240.1
Physical Location & Seq
Reverse (-)
263153 .. 264123
971 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000240.1_g000050.1.cds

Sequence Viewer

Length: 417 bp
atgttgtataacttgatggccatcttgaaaaggctggatattggtcttaggctcttgaatggaaacaaactatcgggttccttgcctgatgagctcggttctcttgaaaatctacgtagactacaagttgacgagaaccatctttcagggtcaataccaaaatcatttcttaacttgcgcggcttaaaacacctccatatgaacaacaactccttcagcggccaaattccatctgagatttctgaaatacccgctcttcttcatgtgctcttggataataataacttatctggatatcttccaccagacttctccaacataccagagttgcgcatacttcaactcgataacaacaacttcacgggaactgagattccagctacttatggaaccctttccggattggtaaagttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

138

Amino Acids

15.29

Weight (kDa)

6.04

Isoelectric Point (pI)

39.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 332
AccBSI CCGCTC 1 cut(s) 254
AccI GTMKAC 1 cut(s) 118
AccII CGCG 1 cut(s) 180
AccIII TCCGGA 1 cut(s) 398
AciI CCGC 3 cut(s) 180, 219, 252
AcoI YGGCCR 2 cut(s) 18, 220
AcsI RAATTY 1 cut(s) 225
AcuI CTGAAG 1 cut(s) 199
AgsI TTSAA 4 cut(s) 28, 58, 107, 341
AloI GAACNNNNNNTCC 4 cut(s) 194, 226, 358, 390
AluBI AGCT 2 cut(s) 94, 380
AluI AGCT 2 cut(s) 94, 380
Alw21I GWGCWC 2 cut(s) 96, 270
Aor13HI TCCGGA 1 cut(s) 398
AoxI GGCC 2 cut(s) 18, 220
ApoI RAATTY 1 cut(s) 225
Asp700I GAANNNNTTC 1 cut(s) 394
AspLEI GCGC 2 cut(s) 180, 333
BalI TGGCCA 1 cut(s) 20
BanII GRGCYC 1 cut(s) 96
Bbv12I GWGCWC 2 cut(s) 96, 270
BccI CCATC 4 cut(s) 10, 29, 147, 238
BisI GCNGC 2 cut(s) 181, 220
BlsI GCNGC 2 cut(s) 182, 221
BmiI GGNNCC 2 cut(s) 79, 391
BsaAI YACGTR 1 cut(s) 116
BsaBI GATNNNNATC 1 cut(s) 20
BsaWI WCCGGW 1 cut(s) 398
BsaXI ACNNNNNCTCC 2 cut(s) 194, 224
Bse8I GATNNNNATC 1 cut(s) 20
BseAI TCCGGA 1 cut(s) 398
BseJI GATNNNNATC 1 cut(s) 20
BseMII CTCAG 2 cut(s) 225, 360
Bsh1236I CGCG 1 cut(s) 180
BshFI GGCC 2 cut(s) 20, 222
BsiHKAI GWGCWC 2 cut(s) 96, 270
BsiSI CCGG 1 cut(s) 399
BsnI GGCC 2 cut(s) 20, 222
Bsp1286I GDGCHC 2 cut(s) 96, 270
Bsp13I TCCGGA 1 cut(s) 398
BspACI CCGC 3 cut(s) 180, 219, 252
BspANI GGCC 2 cut(s) 20, 222
BspCNI CTCAG 2 cut(s) 226, 361
BspEI TCCGGA 1 cut(s) 398
BspFNI CGCG 1 cut(s) 180
BspLI GGNNCC 2 cut(s) 79, 391
BspQI GCTCTTC 1 cut(s) 261
BsrBI CCGCTC 1 cut(s) 254
Bst6I CTCTTC 1 cut(s) 261
BstBAI YACGTR 1 cut(s) 116
BstDEI CTNAG 3 cut(s) 47, 234, 369
BstFNI CGCG 1 cut(s) 180
BstHHI GCGC 2 cut(s) 180, 333
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstSNI TACGTA 1 cut(s) 116
BstUI CGCG 1 cut(s) 180
BsuRI GGCC 2 cut(s) 20, 222
CfoI GCGC 2 cut(s) 180, 333
CviAII CATG 1 cut(s) 263
CviJI RGCY 7 cut(s) 20, 34, 52, 94, 183, 222, 380
CviKI_1 RGCY 7 cut(s) 20, 34, 52, 94, 183, 222, 380
DdeI CTNAG 3 cut(s) 47, 234, 369
EaeI YGGCCR 2 cut(s) 18, 220
Eam1104I CTCTTC 1 cut(s) 261
EarI CTCTTC 1 cut(s) 261
Ecl136II GAGCTC 1 cut(s) 94
Eco105I TACGTA 1 cut(s) 116
Eco24I GRGCYC 1 cut(s) 96
Eco32I GATATC 1 cut(s) 296
Eco53kI GAGCTC 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 199
EcoICRI GAGCTC 1 cut(s) 94
EcoRV GATATC 1 cut(s) 296
EcoT38I GRGCYC 1 cut(s) 96
FaeI CATG 1 cut(s) 266
FaiI YATR 7 cut(s) 9, 198, 200, 264, 320, 335, 387
FatI CATG 1 cut(s) 262
FauI CCCGC 1 cut(s) 259
FauNDI CATATG 1 cut(s) 198
FblI GTMKAC 1 cut(s) 118
Fnu4HI GCNGC 2 cut(s) 181, 220
FriOI GRGCYC 1 cut(s) 96
Fsp4HI GCNGC 2 cut(s) 181, 220
FspI TGCGCA 1 cut(s) 332
GlaI GCGC 2 cut(s) 179, 332
GluI GCNGC 2 cut(s) 181, 220
HaeIII GGCC 2 cut(s) 20, 222
HapII CCGG 1 cut(s) 399
HhaI GCGC 2 cut(s) 180, 333
Hin1II CATG 1 cut(s) 266
Hin6I GCGC 2 cut(s) 178, 331
HinP1I GCGC 2 cut(s) 178, 331
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HinfI GANTC 1 cut(s) 373
HpaII CCGG 1 cut(s) 399
Hpy166II GTNNAC 2 cut(s) 119, 130
Hpy188I TCNGA 2 cut(s) 235, 244
Hpy188III TCNNGA 5 cut(s) 25, 55, 104, 291, 399
Hpy8I GTNNAC 2 cut(s) 119, 130
HpyAV CCTTC 1 cut(s) 223
HpyCH4IV ACGT 1 cut(s) 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 3 cut(s) 47, 234, 369
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 1 cut(s) 266
HspAI GCGC 2 cut(s) 178, 331
Kpn2I TCCGGA 1 cut(s) 398
LguI GCTCTTC 1 cut(s) 261
LpnPI CCDG 8 cut(s) 20, 99, 132, 276, 318, 336, 390, 412
MaeII ACGT 1 cut(s) 115
MbiI CCGCTC 1 cut(s) 254
MboII GAAGA 3 cut(s) 248, 251, 290
MhlI GDGCHC 2 cut(s) 96, 270
MlsI TGGCCA 1 cut(s) 20
MluCI AATT 1 cut(s) 225
MluNI TGGCCA 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 339
MnlI CCTC 1 cut(s) 203
Mox20I TGGCCA 1 cut(s) 20
MroI TCCGGA 1 cut(s) 398
MroXI GAANNNNTTC 1 cut(s) 394
MscI TGGCCA 1 cut(s) 20
MseI TTAA 2 cut(s) 171, 185
Msp20I TGGCCA 1 cut(s) 20
MspA1I CMGCKG 1 cut(s) 219
MspI CCGG 1 cut(s) 399
MvnI CGCG 1 cut(s) 180
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeI CATATG 1 cut(s) 198
NlaIII CATG 1 cut(s) 266
NlaIV GGNNCC 2 cut(s) 79, 391
NsbI TGCGCA 1 cut(s) 332
PciSI GCTCTTC 1 cut(s) 261
PdmI GAANNNNTTC 1 cut(s) 394
PfeI GAWTC 1 cut(s) 373
PkrI GCNGC 2 cut(s) 182, 221
Ppu21I YACGTR 1 cut(s) 116
Psp124BI GAGCTC 1 cut(s) 96
PspN4I GGNNCC 2 cut(s) 79, 391
SacI GAGCTC 1 cut(s) 96
SapI GCTCTTC 1 cut(s) 261
SaqAI TTAA 2 cut(s) 171, 185
SatI GCNGC 2 cut(s) 181, 220
SduI GDGCHC 2 cut(s) 96, 270
SetI ASST 4 cut(s) 96, 118, 195, 382
SnaBI TACGTA 1 cut(s) 116
Sse9I AATT 1 cut(s) 225
SsiI CCGC 3 cut(s) 180, 219, 252
SstI GAGCTC 1 cut(s) 96
TaiI ACGT 1 cut(s) 118
TaqI TCGA 1 cut(s) 345
TasI AATT 1 cut(s) 225
TauI GCSGC 2 cut(s) 183, 222
TfiI GAWTC 1 cut(s) 373
Tru1I TTAA 2 cut(s) 171, 185
Tru9I TTAA 2 cut(s) 171, 185
TspDTI ATGAA 2 cut(s) 215, 251
XapI RAATTY 1 cut(s) 225
XmiI GTMKAC 1 cut(s) 118
XmnI GAANNNNTTC 1 cut(s) 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.